Patenty so značkou «rekombinantné»

Gén izolovaný z Corynebacterium glutamicum, rekombinantné koryneformné baktérie a spôsob produkcie L-lyzínu alebo L-treonínu


Číslo patentu: 287997

Dátum: 27.08.2012

Autori: Burke Kevin, Stapelton Cliona, Mccormack Ashling, Dunican Kieran (zomrel), Möckel Bettina, Eggeling Lothar, Moritz Bernd, Thierbach Georg, Sahm Hermann

MPK: C12N 15/77, C12N 15/53, C12P 13/08...

Značky: corynebacterium, bakterie, izolovaný, rekombinantné, koryneformné, l-lyzínu, produkcie, l-treonínu, glutamicum, spôsob

Zhrnutie / Anotácia:

Gén izolovaný z Corynebacterium glutamicum, označovaný ako gén zwf, pripraviteľný z C. glutamicum ATCC 13032 pomocou PCR s použitím nasledujúceho olígonukleotídového priméru: zwf-dopredný, SEQ ID č.: 10: 5'-TCG ACG CGG TTC TGG AGC AG-3', zwf-reverzný, SEQ ID č.: 11: 5'-CTA AAT TAT GGC CTG CGC CAG -3' a kódujúci polypeptid, ktorý vykazuje aktivitu glukóza-6-fosfát-dehydrogenázy, pričom tento polypeptid obsahuje N-koncovú aminokyselinovú...

Lyofilizované rekombinantné VWF prípravky


Číslo patentu: E 14174

Dátum: 21.10.2009

Autori: Haidweger Eva, Turecek Peter, Schnecker Kurt

MPK: A61K 47/12, A61K 38/36, A61K 38/16...

Značky: lyofilizované, rekombinantné, přípravky


...HEPES, Tris a kombinácie týchto látok. V ďalšom uskutočnení bol ako tlmivý prostriedok použitý citrát. V rôznych uskutočneniach bolo pH v rozsahu od približne 6,0 do približne 8,0, od približne 6,5 do približne 7,5 alebo okolo 7,3. V inom uskutočnení bolo pH približne 7,3.0011 Vinom uskutočnení hore uvedená aminokyselina bola vybraná zo skupinykoncentrácia aminokyseliny bola v rozpätí od približne 0,5 mM do približne 300 mM. V ešteinom...

Stabilizované kompozície pre rekombinantne produkovaný faktor VIII


Číslo patentu: E 12318

Dátum: 03.09.2009

Autori: Nilsson Ulrika, Agerkvist Iréne, Österberg Josefin, Rippner Brita, Ivarsson Elsa

MPK: A61K 38/37, A61K 9/19, A61K 31/195...

Značky: produkovaný, faktor, stabilizované, rekombinantné, kompozície


...cmc polyoxyetylén obsahujúcich neiónových detergentov sú teplotne závislé tak, že sa hodnota cmc zvyšuje v nižších teplotách (Alexandridis, P. et al, 1994. Nilsson, M. et al, 2007). Hodnota cmc Poloxameru 188 je aspoň 20-30 mg/ml ve 37 °C (Kabanov, A. V. et al, 1995, 3Alexandrídis, P. et al, 1994, Moghimi, S. M. et al, 2004) a zvyšuje sa na 100 mg/ml v 20 °C (Nakashíma, K. et al, 1994). Podľa týchto publikácii je teda cmc Poloxameru 188 je v...

Rekombinantné bunky produkujúce omega-aminokarboxylové kyseliny, estery omega-aminokarboxylových kyselín alebo ich laktámy


Číslo patentu: E 18690

Dátum: 12.12.2008

Autori: Müller Andreas, Eggert Thorsten, Bühler Bruno, Häger Harald, Sieber Volker, Schmid Andreas, Jach Guido, Blank Lars, Lalla Bernd, Schullehner Katrin, Grammann Katrin, Haas Thomas, Weckbecker Andrea, Karau Andreas, Welters Peter

MPK: C08G 69/14, C08G 69/08, C12N 15/09...

Značky: omega-aminokarboxylových, kyselin, rekombinantné, omega-aminokarboxylové, estery, kyseliny, produkújuce, buňky, laktamy


...riešeniu vyššie uvedených úloh prispieva bunka, ktorá je v porovnaní s jej divým typom geneticky modifikované tak, že v porovnaní s jej divým typom je schopná zkarboxylových kyselín alebo esterov karboxylových kyselín produkovať viac(o-aminokarboxylových kyselín, viac esterov co-aminokarboxylových kyselín alebo viac laktámov odvodených z w-aminokarboxylových kyselín, pričom bunka vykazuje aktivituenzýmov E 1 a Em alebo enzýmov E 1, En a Em...

Rekombinantne modifikovaný plazmín


Číslo patentu: E 18413

Dátum: 25.11.2008

Autor: Novokhatny Valery

MPK: C12N 15/09, C12N 9/68

Značky: modifikovaný, rekombinantné, plazmín


...rekombinantný proteín, ktorý disponuje požadovanými vlastnosťami (napr. oblasti chemickej štruktúry, ktoré sú nativne) plazmínu/plazminogénu, nemá niektoré negatívne vlastností a je schopný produkcie v expresných systémoch pre rekombinantné proteíny, vrátane bakteriálnych buniek vo0008 Vpatentovej prihláške PCT W 0 2007/047874 A je opísaný delta-plazmínogén,plazminogén s delečným mutantom, v ktorom je stredná časť molekuly odstránená,...

Rekombinantné protilátky na liečenie ľudí


Číslo patentu: 285960

Dátum: 07.11.2007

Autori: Newman Roland, Raab Ronald, Hanna Nabil

MPK: C07K 16/00, A61K 38/00, C07K 16/18...

Značky: liečenie, ľudí, rekombinantné, protilátky

Zhrnutie / Anotácia:

Opisuje sa chimérna protilátka, ktorá sa viaže špecificky k ľudskému antigénu, je neimunogénna u človeka a nie je taká istá ako ľudská alebo šimpanzia protilátka a ktorá obsahuje polypeptidy s ľahkým a ťažkým reťazcom, z ktorých každý obsahuje: variabilnú oblasť, ktorá má aminokyselinovú sekvenciu variabilnej oblasti protilátky opice Starého sveta vybranej z makakov rézus, makakov jávskych a paviánov, konštantnú oblasť, ktorá má aminokyselinovú...

Rekombinantné novirhabdovírusy a ich použitie


Číslo patentu: E 17224

Dátum: 15.06.2007

Autori: Harmache Abdallah, Koumans Joseph, Bremont Michel

MPK: C12N 15/85

Značky: použitie, rekombinantné, novirhabdovírusy


...oblasti medzi M a G génmi IHNV. Konkretnejšie, pretože tento gén sa vložil v prirodne sa vyskytujúcom Eagľ reštrikčnom mieste umiestnenom medzi koncom M ORF a transkričným terminálnym signálom M génu, tento konštruktobsahoval sekvenciu (CCAAGACAGAAAAAAATGGCAC SEQ ID NO l)(CCAAGACAGAAAAAAA SEQ ID NO 2), nasledoval ne-transkribovaný intergénový dinukleotid TG a transkripčná iniciačná sekvencia GCAC, po uvedenej sekvencii bezprostredne...

Rekombinantné N-glykozylované proteíny z prokaryotických buniek


Číslo patentu: E 18568

Dátum: 10.05.2006

Autori: Kowarik Michael, Aebi Markus, Ahuja Umesh

MPK: C12P 21/00, C07K 14/25, C07K 14/205...

Značky: prokaryotických, n-glykozylované, proteiny, buniek, rekombinantné


...modelového proteínu AcrA0010 Cieľom predloženého vynálezu je poskytnúť proteíny, a tiež prostriedky a spôsoby výroby týchto proteínov, ktoré majú optimalizovanú účinnosť pri N-glykozylácii a možno ich vyrobiť v prokaryotických organizmoch in vivo. Ďalším cieľom predloženého vynálezu je nájsť účinnejšie zavedenie Nglykánov do rekombinantných proteínov pre modiñkáciu antigenicity, stability,biologickej, profylaktickej a/alebo terapeutickej...

Spôsob zlepšenej izolácie rekombinantne tvorených proteínov


Číslo patentu: E 9374

Dátum: 29.03.2006

Autor: Winge Stefan

MPK: C12P 21/02, C07K 14/755

Značky: tvořených, proteínov, rekombinantné, zlepšenej, izolácie, spôsob


...tohto pôsobenia na rýchlosťexpresie rôznych proteínov. A nakoniec, P. M. Dey et al., Planta 202 179-187, opisujú izoláciu glykoproteínov bohatých na hydroxyprolín zo suspenznej kultúry buniek zemiakov premytím zemiakových buniek roztokom obsahujúcim 50 mM CaClg a 2 mM kyselinu askorbovú.0007 Čo sa týka vyššie uvedeného, je zrejmé, že je stále žiadúci všeobecný spôsob na zvýšenie výťažku rekombinantných proteínov z eukaryotických alebo...

Chimérické rekombinantné antigény Toxoplazma gondii


Číslo patentu: E 7514

Dátum: 27.02.2006

Autori: Gargano Nicola, Beghetto Elisa, Spadoni Andrea

MPK: C07K 19/00

Značky: toxoplazma, gondii, rekombinantné, chimerické, antigény


...Kanso), potom neskôr ako izolácia čistých antigénov (EP 0 082 745, Mérieux EP 0 301 961, INSERM,Pasteur W 0 89/5658, Transgene) a charakterizácia ako proteínov, tak ich príslušných génov (W 0 89/08700, U. Leland, Dartmouth Coll. US 4 877 726, Res. Inst. Palo Alto W 0 89/12683, INSERM, Pasteur EP 0 391 319, Mochida Pharm. IT 1 196 817, CNR EP 0 431 541, Behringwerke W 0 92/01067, CNRS W 0 92/02624, U. Flinders W 0 92/11366, Innogenetics,...

Rekombinantne modifikovaný plazmín


Číslo patentu: E 18535

Dátum: 21.04.2005

Autori: Hunt Jennifer Audrey, Novokhatny Valery

MPK: C12N 9/68, C12N 5/10, C12N 15/57...

Značky: plazmín, modifikovaný, rekombinantné


...z 90 , 95 alebo 98 identický so sekvencíou ukázanou vsekv. id. č. 2. Okrem toho kódovaný polypeptid môže byť sekvencia ukázaná v sekv. id. č. 2.0009 Nukleotídová sekvencia polynukleotidu môže byť sekvencia ukázaná v sekv. id. č. l alebo jej degenerované varianty. Nukleotídová sekvencia môže kódovať polypeptid majúci Nkoncovú kringle doménu homológnu s kringle doménou 1 natívneho humánneho plazminogénu a miesto aktivácie C-koncovej domény...

Rekombinantne modifikovaný plazmín


Číslo patentu: E 8081

Dátum: 21.04.2005

Autori: Novokhatny Valery, Hunt Jennifer Audrey

MPK: C12N 9/68

Značky: rekombinantné, plazmín, modifikovaný


...môžu mať polypeptidy vyššiu väzobnú afinitu pre čiastočne rozštiepený fibrín,ako je väzobná aktivita pre čiastočne nerozštiepený fibrín mini-plazmín.0015 V niektorých uskutočneniach polypeptidy môžu mať takú sekvenciu aminokyselín, ako znázorňuje SEQ ID NO 2 a jej konzervatívne substitúcie. Polypeptidy môžu mať zvyšok v relatívnej polohe analógnej k polohe 76 aminokyselinovej sekvencii zaznamenanej V SEQ ID NO 2, čo je arginín.0016 V...

Rekombinantné vakcíny a ich použitie


Číslo patentu: E 13583

Dátum: 13.10.2004

Autori: Türeci Özlem, Sahin Ugur, Kreiter Sebastian

MPK: C07K 14/47, A61K 31/7088, A61K 38/17...

Značky: rekombinantné, použitie, vakcíny


...Cieľom očkovania rekombinantnou vakcínou je indukovať protidefinovanému antigénu špecifickú imunitnú reakciu, ktorá jepreventívne alebo terapeuticky účinná proti definovaným0007 Dôležitým faktorom pre účinnosť rekombinantnej vakcíny je optimálna stimulácia T-lymfocytov imunizovaného organizmu. Napríklad rad výskumov založených na experimentoch na zvieratách potvrdzuje, že na účinnú imunoterapiu nádorov je nutná optimálna stimulácia CD 8 a...

Rekombinantné vírusové vakcíny proti malárii


Číslo patentu: E 11288

Dátum: 16.12.2003

Autori: Holterman Lennart, Pau Maria Grazia, Kaspers Jorn, Stegmann Antonius Johannes Hendrikus

MPK: A61K 39/015, C12N 15/30, C07K 14/445...

Značky: vakcíny, vírusové, rekombinantné, malárii, proti


...dostupná vakcína proti malárii, napriek tomu, že vývoj vakcín proti malárii bol zahájený užpred viac ako 30 rokmi imunizácia potkanov, primátov iného ako ľudského pôvodua ľudských jedincov sporozoitmi oslabenými ožiarenim poskytuje ochranu pred následnou nákazou sporozoitmi (Nussenzweig et al. 1967 Clyde et al. 1973). Avšak nedostatok vhodného veľkokapacitného kultivačného systému na produkciu sporozoitov zabraňuje širšíemu rozšíreniu...

Rekombinantné protilátky proti interleukínu-5


Číslo patentu: 282625

Dátum: 23.09.2002

Autori: Bodmer Mark William, Athwal Diljeet Singh, Emtage John Spencer

MPK: C07K 16/24, C12N 15/13, A61K 39/395...

Značky: proti, rekombinantné, interleukínu-5, protilátky

Zhrnutie / Anotácia:

Je opísaná rekombinantná protilátková molekula, ktorá má afinitu pre ľudský IL-5 antigén, DNA sekvencia kódujúca ťažký a/alebo ľahký reťazec protilátky, farmaceutická kompozícia obsahujúca protilátku a použitie protilátky na výrobu liečiva.

Sekvencie DNA, rekombinantné molekuly DNA a spôsob výroby polypeptidov podobných rastovému hormónu ošípanej


Číslo patentu: 278336

Dátum: 04.12.1996

Autori: Schulz Marie-francoise, Movva Nageswararao

MPK: C12N 15/64, C12N 15/70, C12N 15/18...

Značky: spôsob, hormonu, molekuly, rekombinantné, polypeptidov, rastovému, podobných, ošípanej, výroby, sekvencie

Zhrnutie / Anotácia:

Opisujú sa sekvencie DNA, rekombinantné molekuly DNA a spôsoby výroby rastového hormónu ošípanej (SGH) a polypeptidov s účinnosťou rastového hormónu ošípanej. Tieto peptidy sa môžu využiť pri výrobe polypeptidov určených pre ošípané ako všeobecné anaboliká, na zintenzívnenie rastu a zvýšenie produkcie mäsa týchto zvierat.

Biologický spôsob výroby kyseliny 7-aminodeacetylcefalosporánovej a kyseliny 7-aminocefalosporánovej, rekombinantné DNA expresné vektory a rekombinantné produkčné kmene Penicillium chrysogenum na vykonávanie tohto spôsobu a použitie rekombinantnýc…


Číslo patentu: 280569

Dátum: 06.11.1996

Autori: Rambosek John, Mcada Phyllis, Crawford Lorilee, Conder Michael, Stepan Anthony Michael, Reeves Christopher

MPK: C12N 15/52, C12N 1/15, C12P 35/02...

Značky: vektory, biologicky, použitie, produkčné, kyseliny, rekombinantnýc, expresné, 7-amínocefalosporánovej, penicillium, tohto, výroby, kmene, rekombinantné, vykonávanie, 7-aminodeacetylcefalosporánovej, spôsobu, spôsob, chrysogenum

Zhrnutie / Anotácia:

Medziprodukty sú dôležité na prípravu cefalosporínových antibiotík, kyseliny 7-aminodeacetylcefalosporánovej, 7-ADAC a kyseliny 7-aminocefalosporánovej 7-ACA. Tieto kyseliny sa pripravujú novým biologickým spôsobom, pri ktorom sa pestuje transformovaný kmeň Penicillium chrysogenum v prítomnosti adipátu za vzniku adipoyl-6-APA s následnou expresiou génov, použitých na transformáciu a to 1. génu pre expandázu za vzniku adipoyl-7-ADAC, 2. génu pre...

Imunogénne polypeptidy schopné vyvolať imunitnú odpoveď proti parazitom rodu Eimeria, DNA kódujúca tieto polypeptidy, rekombinantné vektory a transformované mikroorganizmy, spôsoby ich prípravy a vakcína proti kokcidióze


Číslo patentu: 281606

Dátum: 07.09.1994

Autori: Pasamontes Luis, Binger Mary-helen

MPK: A61K 39/002, C07K 5/08, C07K 14/455...

Značky: transformované, imunogénne, rekombinantné, imunitnú, přípravy, polypeptidy, schopné, mikroorganizmy, parazitom, tieto, kódujúca, vakcína, proti, spôsoby, eimeria, odpoveď, vyvolať, kokcidióze, vektory

Zhrnutie / Anotácia:

Polypeptid so sekvenciou aminokyselín a jeho fragmenty, ktoré sú schopné vyvolať imunitnú odpoveď proti parazitom rodu Eimeria, DNA kódujúca tieto polypeptidy a rekombinantné vektory. Ďalej je opísaný spôsob prípravy polypeptidu, rekombinantného vektora, rekombinantného vírusu a transformovaného mikroorganizmu. Imunogénny polypeptid je použiteľný na imunizáciu subjektu proti kokcidióze. Vakcína obsahujúca opísaný polypeptid, rekombinantný vírus...