Patenty so značkou «kombinácie»

Štvortaktné piestové spaľovacie motory a ich kombinácie využívajúce energiu paliva aj energiu výfukových plynov


Číslo patentu: U 7026

Dátum: 03.02.2015

Autori: Lábaj Ján, Špánik Pavol, Dobrucký Branislav, Mikulovský Jaroslav, Mikulovská Lucia

MPK: F02G 5/00, F02B 47/02

Značky: plynov, štvortaktné, spaľovacie, piestové, energiu, paliva, motory, využívajúce, výfukových, kombinácie


...objem vo valci l a stlačená pružina v expanznej komore 19 vystrelí piest do homého úvratu a vytlačí expanduj úcu zmes výfukových plynov, tlakovej tekutiny z expanznej komory 10 cez otvorený výfukový ventil Z do valca, kde tlakom na piest g realizuje druhý pracovný cyklus.Tretia technológia pracovných cyklov využíva v dvoch krajných valcoch j energiu paliva tak ako súčasné štvortaktne motory, v jednom pri trojvalci alebo dvoch pri...

Dvojtaktné piestové spaľovacie motory a ich kombinácie využívajúce energiu paliva aj energiu výfukových plynov


Číslo patentu: U 7025

Dátum: 03.02.2015

Autori: Dobrucký Branislav, Lábaj Ján, Špánik Pavol, Mikulovská Lucia, Mikulovský Jaroslav

MPK: F02G 5/02, F02B 47/02

Značky: výfukových, využívajúce, energiu, dvojtaktné, kombinácie, spaľovacie, motory, piestové, plynov, paliva


...plynov na on-line spriahnuté riadenie, priebežné sledovanie a vyhodnocovanie okamžitého stavu procesu, údajov potrebných na riadenie dvoch druhov pracovných procesov, ktoré využívajú dva druhy energií realizovaných tromi technológiami pracovných cyklov.I-llavné časti riadiacej jednotky 3 Q komplexného riadiaceho systému dvojtaktného motora sú riadiaca jednotka a vstrekovača Q paliva do valca l,riadiaca jednotka Q časovania otvárania a...

Použitie pyrimidínovej zlúčeniny, táto pyrimidínová zlúčenina, farmaceutické kompozície túto zlúčeninu obsahujúce, spôsob prípravy tejto kompozície a tejto zlúčeniny a kombinácie a produkt obsahujúce túto zlúčeninu


Číslo patentu: 287996

Dátum: 27.08.2012

Autori: Janssen Paul Adriaan Jan, Ho Chih Yung, Kukla Michael Joseph, De Jonge Marc René, Koymans Lucien Maria Henricus, Ludovici Donald William, Andries Koenraad Jozef Lodewijk Marcel, Van Aken Koen Jeanne Alfons, Janssen Marcel August Constant, De Corte Bart, Heeres Jan

MPK: A61K 31/505, C07D 239/46, C07D 239/42...

Značky: kompozície, spôsob, pyrimidínovej, přípravy, tejto, táto, kombinácie, farmaceutické, túto, použitie, pyrimidínová, obsahujúce, zlúčeniny, zlúčeninu, zlúčenina, produkt

Zhrnutie / Anotácia:

Opísané je použitie pyrimidínových zlúčenín na prípravu liečiva určeného na liečenie subjektov, ktoré trpia infekciou HIV, a pyrimidínové zlúčeniny všeobecného vzorca (I), ktoré sú schopné inhibovať replikáciu HIV, spôsob prípravy týchto zlúčenín a farmaceutických kompozícií, kombinácií a produktov, ktoré uvedené zlúčeniny obsahujú.

Kombinácie účinných zlúčenín obsahujúce derivát karboximidu a fungicídnu zlúčeninu


Číslo patentu: E 20281

Dátum: 18.04.2012

Autori: Seitz Thomas, Dahmen Peter, Dubost Christophe, Desbordes Philippe, Helmke Hendrik, Göhlich Frank, Gary Stéphanie, Wachendorff-neumann Uirike, Wetcholowsky Ingo

MPK: A01N 37/24, A01N 37/34, A01N 37/46...

Značky: obsahujúce, fungicídnu, zlúčenín, karboximidu, účinných, kombinácie, zlúčeninu, derivát


...účinných zlúčenín podľa vynálezu a v aplikačných dávkach, v ktorých jednotlivé zlúčeniny samostatne nevykazujú žiadnu alebo prakticky žiadnu účinnosť výhodné chovanie pri príprave formulácie alebo pri používaní,napriklad pri mletí, preosievaní, emulgovaní, rozpúšťaní alebo dispergovaní zlepšená stabilita pri skladovaní a stabilita voči pôsobeníu svetla výhodné vlastnosti z hľadiska tvorby zvyškov zlepšenć toxikologické alebo...

Farmaceutické kombinácie obsahujúce combretastatín a protinádorové činidlo


Číslo patentu: 287908

Dátum: 20.02.2012

Autor: Bissery Marie-christine

MPK: A61K 31/138, A61K 31/4745, A61K 31/47...

Značky: protinádorově, combretastatín, farmaceutické, obsahujúce, činidlo, kombinácie

Zhrnutie / Anotácia:

Opisuje sa farmaceutická kombinácia, ktorá obsahuje účinné množstvo protirakovinovej zlúčeniny zvolenej zo skupiny pozostávajúcej z taxotéru, vinorelbínu a doxorubicínu, v kombinácii s účinným množstvom combretastatínu vzorca (IIa). Combretastatín môže byť vo forme hydrochloridovej soli.

Kombinácie oxazolidinónov s inými účinnými látkami, spôsob ich výroby, lieky tieto látky obsahujúce a ich použitie


Číslo patentu: 287904

Dátum: 20.02.2012

Autori: Lampe Thomas, Röhrig Susanne, Pohlmann Jens, Perzborn Elisabeth, Pernerstorfer Josef, Straub Alexander, Schlemmer Karl-heinz

MPK: A61K 31/422, C07D 495/04, A61K 31/4365...

Značky: lieky, spôsob, použitie, účinnými, inými, výroby, tieto, kombinácie, látkami, látky, obsahujúce, oxazolidinónov

Zhrnutie / Anotácia:

Opisujú sa kombinácie A) oxazolidinónov vzorca (I) s B) inými účinnými látkami, spôsob ich výroby a ich použitie ako liekov, obzvlášť na profylaxiu a/alebo ošetrenie tromboembolických ochorení.

Synergické farmaceutické kombinácie obsahujúce inhibítor renínu


Číslo patentu: 287881

Dátum: 23.01.2012

Autori: Hewitt William, Vasella Daniel Lucius, Webb Randy Lee

MPK: A61P 9/00, A61K 31/165

Značky: farmaceutické, reninu, synergické, kombinácie, inhibitor, obsahujúce

Zhrnutie / Anotácia:

Opisuje sa kombinácia obsahujúca inhibítor renínu vzorca (I) alebo jeho farmaceuticky prijateľnú soľ.

Kombinácie vildagliptínu a glimepiridu


Číslo patentu: E 15306

Dátum: 21.12.2011

Autori: Türkyilmaz Ali, Ergenekon Ercan, Karaköy Basak Acar, Saydam Mehtap, Cifter Ümit

MPK: A61K 9/00, A61K 31/33, A61K 9/20...

Značky: vildagliptínu, glimepiridu, kombinácie

Text: použitie pri diabetických ochoreniach.0024 Ďalším predmetom tohto vynálezu je získat kombináciu vildagliptinu a glimepiridu, ktorá má požadované úrovne kompatibility.-3 0025 Ďalším predmetom tohto vynálezu je vyvinúť povlak. ktorý zabezpečí stabilitu formulácil obsahujúcich vildagliptln a glimepirid a neovplyvňuje ich rozpustnosť a rýchlosti rozpúšťania.0026 A dalším predmetom tohto vynálezu je ziskat kombináciu vildagliptlnu a glimepiridu,...

Farmaceutické kombinácie a kompozície obsahujúce kyselinu (E)-7-{4-(4-fluórfenyl)-6-izopropyl-2- [metyl(metylsulfonyl)amino]pyrimidin-5-yl}-(3R, 5S)-3,5-dihydroxyhept-6-énovú


Číslo patentu: 287792

Dátum: 12.09.2011

Autori: Cotter Mary Anne, Cameron Norman Eugene

MPK: A61K 31/41, A61K 31/4164, A61K 31/00...

Značky: kyselinu, kompozície, metyl(metylsulfonyl)amino]pyrimidin-5-yl}-(3r, farmaceutické, obsahujúce, kombinácie, 5s)-3,5-dihydroxyhept-6-énovú, e)-7-{4-(4-fluórfenyl)-6-izopropyl-2

Zhrnutie / Anotácia:

Opisujú sa farmaceutické kombinácie a farmaceutické kompozície obsahujúce kyselinu (E) -7-{4-(4-fluórfenyl)-6-izopropyl-2- [metyl(metylsulfonyl)amino]pyrimidin-5-yl}-(3R,5S)-3,5-dihydroxyhept-6-énovú alebo jej farmaceuticky prijateľnú soľ a ACE inhibítor alebo inhibítor aldózareduktázy, alebo antagonistu angiotenzínu II.

Použitie kombinácie inhibítora sínusového prúdu If a inhibítora enzýmu konvertujúceho angiotenzín na liečenie srdcovej nedostatočnosti so zachovanou systolickou funkciou


Číslo patentu: E 19251

Dátum: 14.06.2011

Autori: Lerebours-piegeonniere Guy, Vilaine Jean-paul, Fratacci Marie-dominique, Roussel Jérôme, Feldmann Luc, Mulder Paulus, Thuillez Christian

MPK: A61K 31/55, A61K 45/06, A61K 31/4045...

Značky: srdcovej, nedostatočnosti, systolickou, angiotenzín, sínusového, použitie, inhibítora, liečenie, kombinácie, zachovanou, konvertujúceho, enzymů, funkciou, prúdu


...dysfunkciou ľavej srdcovej komory už nie je jedinou formou srdcovej nedostatočnosti. Stále častejšie majú pacienti, ktorí trpia srdcovou nedostatočnosťou, ejekčnú frakciu vyššiu než 40 . Podiel srdcovej nedostatočnosti nazývanej diastolická (alebo skôr so zachovanou systolickou funkciou) sa s vekom zvyšuje. Aktuálne činí 30 až 40 z hospitalizácií kvôli srdcovej nedostatočnosti a po 80. roku prekračuje vo výskyte srdcová nedostatočnosť so...

Použitie jedného alebo kombinácie viacerých fytokanabinoidov pri liečbe epilepsie


Číslo patentu: E 16546

Dátum: 29.06.2010

Autori: Kikuchi Tetsuro, Whalley Ben, Williams Claire, Stephens Gary, Wright Stephen, Guy Geoffrey

MPK: A61K 31/352, A61P 25/08

Značky: liečbe, epilepsie, fytokanabinoidov, jedného, použitie, viacerých, kombinácie


...líši od pacienta kpacientovi (McCormick and Contreras, 2001, Lutz, 2004) avýzvou je nájdenie liekov účinných proti týmto rôznym typom záchvatov.0016 Neuronálna aktivita je predpokladom správneho fungovania mozgu. Narušenie excitačno-inhibičnej rovnováhy neuronálnej aktivity však môže vzbudzovať epileptické záchvaty. Tieto epileptické záchvaty môžu byť zoskupené dodvoch základných kategórií čiastočné ageneralizované záchvaty. Čiastočné...

Použitie kombinácie metabolického derivátu loratadínu a nesteroidnej protizápalovej látky alebo nenarkotického analgetika na výrobu liečiva na liečenie kašľa a iných ochorení


Číslo patentu: 287257

Dátum: 25.03.2010

Autori: Mccullough John, Smith Emil, Aberg Gunnar

MPK: A61K 31/4427, A61K 31/445, A61K 31/451...

Značky: nesteroidnej, nenarkotického, metabolického, kombinácie, liečenie, liečivá, výrobu, iných, látky, loratadínu, ochorení, použitie, kašľa, derivátů, protizápalovej, analgetika

Zhrnutie / Anotácia:

Použitie metabolického derivátu loratadínu (DCL) alebo jeho farmaceuticky prijateľnej soli a nesteroidnej protizápalovej látky alebo nenarkotického analgetika alebo jeho farmaceuticky prijateľnej soli na výrobu liečiva na liečenie kašľa, nachladnutia, nachladnutiu podobných a/alebo chrípkových symptómov a s tým spojených ťažkostí, bolestí hlavy, bolesti, horúčky a všeobecnej nevoľnosti u človeka, pričom nedochádza k sprievodnej náchylnosti k...

Kľúčové zariadenie s pohyblivým prvkom kľúčovej kombinácie a zariadenie zámku


Číslo patentu: E 13802

Dátum: 25.08.2009

Autori: Ben-aharon Effi, Markbreit Dani

MPK: E05B 35/00

Značky: kľúčové, kombinácie, kľúčovej, prvkom, zariadenie, zámku, pohyblivým


...pohybujú na sebe nezávisle.0011 Prvá časť aspoň jedného pohyblivého prvku kľúčovejkombinácie obsahuje teleso pohyblivo namontované V dierevytvorenej V driekovej časti, diera je vytvorená s dolným výstupkom, a premiestnenie prvej časti aspoň jedného pohyblivého prvku kľúčovej kombinácie je obmedzené telesom. dosadajúcim. na výstupok.0012 Druhá časť aspoň jedného pohyblivého prvku kľúčovej kombinácie obsahuje pozdĺžne teleso pohyblivo...

Kombinácie makrocyklickej chinoxalínovej zlúčeniny, ktorá je inhibítorom proteázy AN HCV NS3 s inými HCV činidlami


Číslo patentu: E 16916

Dátum: 17.07.2009

Autori: Summa Vincenzo, Harper Steven, Liverton Nigel, Mccauley John

MPK: A61K 38/07, A61K 38/08, A61K 38/06...

Značky: inhibítorom, inými, ktorá, makrocyklickej, kombinácie, činidlami, proteázy, zlúčeniny, chinoxalínovej


...činidlom. Keď to je vhodné môže byť zlúčenina kombinovaná s inými terapeutickými činidlami,zahŕñajúcimi, ale bez obmedzení, HCV antivirotiká, činidlá proti0011 NS 3 inhibítory sú tiež výhodné pri príprave a uskutočnení skreeningových testov pre antivírusové zlúčeniny. Napríklad,takéto zlúčeniny sa môžu použiť na izoláciu enzýmových mutantov,ktoré sú vynikajúcimi skreeningovými nástrojmi pre silnejšie antivírusové zlúčeniny. Ďalej,...

Antineoplastické kombinácie obsahujúce HKI-272 a vinorelbín


Číslo patentu: E 15014

Dátum: 17.06.2009

Autor: Zacharchuk Charles

MPK: A61P 35/00, A61K 31/437

Značky: obsahujúce, kombinácie, hki-272, vinorelbín, antineoplastické


...začinajúc dňom 1 cyklu, a intravenózne podávanie aspoň jednej jednotkovej dávky vinorelbínu v dňoch 1 a 8 cyklu.0015 Opisuje sa režim na liečenie metastatického zhubného nádoru spojeného so zvýšenou expresiou alebo rozšírením HER-2 u subjektu. Jeden cyklus režimu zahrnuje 21 dní a režim zahrnuje orálne podávanie aspoň jednej jednotkovej dávky HKl-272, začínajúc dňom 2 cyklu a intravenózne podávanie aspoň jednej jednotkovej dávky...

Liateľná tuková zmes na praženie a použitie kombinácie esteru kyseliny citrónovej s čiastkovými glyceridmi mastných kyselín a soli


Číslo patentu: 286893

Dátum: 12.06.2009

Autori: Segers Marcel Caroline Henri Maria, Van Oosten Cornelis Willem, Cornelissen Johannes Mattheus

MPK: A23D 9/00

Značky: mastných, citronovej, praženie, glyceridmi, tuková, použitie, kyseliny, kyselin, esterů, kombinácie, liateľná, čiastkovými

Zhrnutie / Anotácia:

Liateľná tuková zmes na praženie obsahuje soľ a ester kyseliny citrónovej s čiastkovými glyceridmi mastných kyselín a má zlepšené sekundárne prskajúce správanie pri plytkom pražení.

Farmaceutické kombinácie


Číslo patentu: E 19776

Dátum: 04.06.2009

Autori: Hilberg Frank, Shapiro David, Stefanic Martin Friedrich, Kaiser Rolf

MPK: A61K 9/48, A61K 31/519, A61K 31/496...

Značky: farmaceutické, kombinácie


...že táto zlúčenina inhibuje signalizáciu vendoteliálnych bunkách a bunkách hladkého svalu avpericytoch, aznižujeOkrem toho sa táto zlúčenina vyznačuje in vivo protinádorovou účinnosťou na všetkých doteraz testovaných modeloch pri dobre tolerovaných dávkach. V nasledujúcej tabuľke sa uvádzajú výsledky in vivo testovania protinádorovej účinnosti na xenotransplantátových modeloch a nanádorovom modeli syngénneho potkana.šRakovina hrubého...

CD37 imunoterapeutikum a kombinácie s jeho bifunkčným chemoterapeutikom


Číslo patentu: E 10205

Dátum: 11.04.2009

Autori: Ledbetter Jeffrey, Tan Philip, Brady William, Morales Cecile, Simon Sandy Alexander, Hayden-ledbetter Martha Susan

MPK: A61P 35/02, A61K 31/4184, A61K 39/395...

Značky: kombinácie, bifunkčným, imunoterapeutikum, chemoterapeutikom


...väzbová molekula z aminokyselinovej sekvencie, ktorá je uvedená v SEKV lD Č 253.0009 Súčasne stým tiež predložený vynález prináša izolovanú molekulu nukleovej kyseliny, ktorá obsahuje nukleotidovú sekvenciu, ktorá kóduje humanizovanú CD 37-špeciñckú väzbovú molekulu podľa predloženého vynálezu.0010 Podľa ďalšieho predmetu predložený vynález prináša Vektor, ktorý obsahuje izolovanú molekulu nukleovej kyseliny, ktorá kóduje...

Herbicídne kombinácie s acylovanými aminofenylsulfonylmočovinami, spôsob ničenia škodlivých rastlín a použitie uvedenej kombinácie


Číslo patentu: 286728

Dátum: 11.03.2009

Autori: Bieringer Hermann, Hacker Erwin

MPK: A01P 13/00, A01N 47/28

Značky: rastlín, uvedenej, ničenia, spôsob, herbicídne, použitie, škodlivých, acylovanými, aminofenylsulfonylmočovinami, kombinácie

Zhrnutie / Anotácia:

Herbicídne prostriedky s acylovanými aminofenylsulfonylmočovinami so základným vzorcom (I), v ktorom majú substituenty významy uvedené v opisnej časti, v kombinácii s jedným alebo viacerými herbicídmi zo skupiny zlúčenín, pozostávajúce zo selektívne v niektorých dvojklíčnych kultúrach proti jednoklíčnym a dvojklíčnym škodlivým rastlinám účinných herbicídov, selektívne v niektorých dvojklíčnych kultúrach proti prevažne dvojklíčnym škodlivým...

Kombinácie herbicídov obsahujúce diflufenikan


Číslo patentu: E 14441

Dátum: 19.02.2009

Autori: Hills Martin, Bickers Udo, Hacker Erwin, Brink Arne

MPK: A01N 43/40, A01N 43/90, A01P 13/02...

Značky: obsahujúce, diflufenikan, kombinácie, herbicídov

Text: v postupe pred vyrašením a po vyrašení bojuje proti relatívne širokému spektru jednoročných a trvalýchburín, burinových tráv, ako aj šachorovítých (Cyperaceen). Pri herbicídnych prostriedkochpodľa vynálezu sú aplikačné nmožstvá spravidla nižšie, napríklad v rozsahu od 50 do 500 g AS/ha, výhodne od 50 do 250 g AS/ha pre komponent A a v rozsahu od 5 do 250 g AS/ha,výhodne od 5 do 100 g AS/ha pre komponent B. uVšeobecne používané pomery...

Pyrol [2,3-d] pyrimidínová zlúčenina, jej použitie na výrobu liečiva, farmaceutická kompozícia s jej obsahom, použitie jej kombinácie s ďalšími činidlami a súpravy s jej obsahom na výrobu liečiva


Číslo patentu: 286640

Dátum: 16.02.2009

Autori: Flanagan Mark Edward, Blumenkopf Todd Andrew, Brown Matthew Frank, Changelian Paul Steven

MPK: C07D 209/00, C07D 239/00, A61K 31/505...

Značky: kombinácie, výrobu, liečivá, pyrimidínová, súpravy, ďalšími, zlúčenina, 2,3-d, činidlami, použitie, pyrol, kompozícia, obsahom, farmaceutická

Zhrnutie / Anotácia:

Zlúčeniny všeobecného vzorca (I), ktoré sú inhibítormi enzýmu proteín tyrozín kinázy, akým je napríklad kináza JAK3 (Janus Kinase), a sú imunosupresívne činidlá použiteľné pri liečbe odhojenia orgánových transplantátov, zožierajúceho vredu, roztrúsenej sklerózy, kĺbového reumatizmu, psoriázy, diabetu typu I a komplikácií vyvolaných diabetom, rakoviny, astmy, atopickej dermatitídy, autoimunitných porúch štítnej žľazy, ulceratívnej kolitídy,...

Kombinácie soli bis-tiazólia, alebo jedného z ich prekurzorov s artemisinínom, alebo jedným z jeho derivátov na liečbu závažnej formy malárie


Číslo patentu: E 10677

Dátum: 05.02.2009

Autori: Fraisse Laurent, Wein Sharon Aurore, Vial Henri

MPK: A61K 31/357

Značky: bis-tiazólia, kombinácie, závažnej, derivátov, liečbu, malárie, jedného, artemisinínom, formy, prekurzorov, jedným


...dnes patria medzi najúčinnejšie látky pôsobiace proti Plasmadium falczparum. Liečenie týmito zlúčeninami však iba ťažko zaistí úplné vyliečenie a často dochádza k recidívam. Použitie artemisínínu alebo jeho derivátov pri monoterapii by teda mohlo predstavovať kauzálny faktor pri selekcii rezistentných kmeňov parazítov.Vedecká komunita v súčasnosti doporučuje použitie kombinácií účinných látok, obzvlášť kombinácie artemisínínu alebo...

Kombinácie transmembránového aktivátora a modulátora vápnika a cyklofilín ligand interaktora (TACI) a činidiel proti CD20 na liečenie autoimunitného ochorenia


Číslo patentu: E 21023

Dátum: 16.10.2008

Autori: Graffner Hans Otto Lennart, Ponce Rafael, Broly Hervé, Peano Sergio

MPK: A61K 39/395, A61P 37/00, A61K 38/17...

Značky: interaktora, činidiel, transmembránového, proti, kombinácie, liečenie, tači, ligand, cyklofilín, ochorenia, autoimunitného, aktivátora, modulátora, vápnika

Text: na pre-B-lymfocytoch a maturovaných B-lymfocytoch (Valentine et al., J. Biol. Chem. 264 (l 9), 11 282 až 11 287 (1989) a Einfeldet al., EMBO J. 7 (3), 711 až 717 (1988. Tento antigen sa tiež exprimuje vo viacerých ako 90 B-bunkových non-Hodgkinovych lymfómoch (NHL) (Anderson et al., Blood 63(6), 1424 až 1433(1984, ale nenachádza sa na hematopoetických kmeňových bunkách, pro-B-bunkách, normálnych. plazmatických bunkách alebo iných...

Kombinácie peptidov vo vakcíne proti alergii na mačky


Číslo patentu: E 8516

Dátum: 30.05.2008

Autori: Hafner Roderick Peter, Larche Mark, Kay Anthony Barrington

MPK: A61K 39/35, A61P 37/08, C07K 7/00...

Značky: vakcíne, kombinácie, proti, alergii, peptidov, mačky


...k desenzibilizácii, založenom na imunizácii peptidmi, sa objavuje jeden problém - ako vybrať správnu veľkosť a oblast z alergénu, na ktorú sa má viazať peptid použitý k imunizácii. Veľkosť vybraného peptidu je kritické. Ak by bol peptid príliš malý, vakcína by nebola efektívna na vyvolanie imunologickej odpovede. Ak sú peptidy príliš veľké, alebo ak jednotlivec príde do styku s celým alergénom, je tu riziko vyvolania opačných reakcií,...

Použitie kombinácie metabolického derivátu loratadínu a pseudoefedrínu na výrobu liečiva na liečenie kašľa a iných ochorení


Číslo patentu: 286079

Dátum: 15.02.2008

Autori: Mccullough John, Aberg Gunnar, Smith Emil

MPK: A61K 31/445, A61P 11/00, A61K 31/44...

Značky: iných, kašľa, derivátů, použitie, výrobu, loratadínu, liečivá, metabolického, liečenie, pseudoefedrínu, ochorení, kombinácie

Zhrnutie / Anotácia:

Použitie metabolického derivátu loratadínu (DCL) alebo jeho farmaceuticky prijateľnej soli a pseudoefedrínu alebo jeho farmaceuticky prijateľnej soli na výrobu liečiva na liečenie kašľa, nachladnutia, nachladnutiu podobných a/alebo chrípkových symptómov a s tým spojených ťažkostí, bolestí hlavy, bolesti, horúčky a všeobecnej nevoľnosti u človeka, pričom nedochádza k sprievodnej náchylnosti k nepriaznivým vedľajším účinkom, spojeným s podávaním...

Kombinácie obsahujúce amidom substituované indazoly ako inhibítory poly(adp-ribóza)polymerázy (PARP)


Číslo patentu: E 16929

Dátum: 08.01.2008

Autori: Schultz-fademrecht Carsten, Ontoria Ontoria Jesus Maria, Scarpeli Rita, Jones Philip

MPK: A61P 29/00, A61P 35/00, A61K 31/4439...

Značky: kombinácie, inhibitory, poly(adp-ribóza)polymerázy, obsahujúce, amidom, substituované, indazoly, parp


...a spôsobuje pokles NAD a ATP na menej než 20 normálnej hladiny. Tento scénar je obzvlášť škodlivý počas ischémie, kedy stráta kyslíka už drasticky obmedzila energetický výkon bunky. Následná produkcia voľnýchradikálov počas reperfúzie je považovaná za hlavnú príčinupoškodenia tkaniva. Časť poklesu ATP, ktorý je typický V mnohých orgánoch počas ischémie a reperfúzie, by mohla byť spojená s vyčerpaním NAD kvôli cyklu poly(ADP-ribózy). Očakáva...

Spôsob výroby L-aminokyseliny použitím baktérie rodiny Escherichia na utlmenie expresie CYNT, CYNS, CYNX alebo CYNR génov alebo ich kombinácie


Číslo patentu: E 12070

Dátum: 03.12.2007

Autori: Voroshilova Elvira Borisovna, Filippov Dmitriy Vladimirovich, Gusyatiner Mikhail Markovich

MPK: C12N 15/60, C12P 13/06, C12N 9/88...

Značky: rodiny, utlmenie, escherichia, bakterie, expresie, použitím, cynt, génov, spôsob, cyns, kombinácie, l-aminokyseliny, výroby


...sekvenčnej identity, Cynx je vyhodnotený ako člen hlavnej prístupnej superrodiny (MFS),ktorá je jednou z dvoch najväčších rodín membránovýcheukaryontoch ako predpokladaný kyanátový transportér (Pao S.S.,Microbiol. And Mol. Biol. Rev.62(1)1-34 (1998.0009 Fyziologická úloha CynT, cyns a cynX bola hodnotená vytvorenün chromozomálnych nmtantov, V ktorých boli tieto gény inaktívne. Delta cynT chromozomálny mutant exprimoval aktívnu kyanázu, ale nie...

Organopolysiloxánová kompozícia, použitie kombinácie TiO2 a pigmentu, spôsob výroby dielcov a dielec


Číslo patentu: 285955

Dátum: 05.11.2007

Autori: George Catherine, Sac Jacques, Pouchelon Alain

MPK: C08K 5/00, C08K 3/00

Značky: výroby, dielec, kompozícia, kombinácie, organopolysiloxánová, spôsob, pigmentů, dielcov, použitie

Zhrnutie / Anotácia:

Opisuje sa peroxidom alebo polyadíciou zosieťovateľná organopolysiloxánová kompozícia obsahujúca diorganopolysiloxánovú gumu, kremičité vystužovacie plnidlo, zosieťujúcu sústavu, aspoň jeden organický alebo anorganický pigment a na poskytnutie farebného, tepelne stabilného elastoméru, ale bez pastelového odtieňa, zosieťovaním, od 0,1 do 5 %, vztiahnuté na hmotnosť kompozície, dispergovaných častíc oxidu titaničitého TiO2 veľkosti najviac 80 nm...

Použitie kombinácie morfínu a aspoň jedného antagonistu opiátov na liečenie závislosti od opiátov a na prevenciu neorálneho zneužívania opiátov u závislých od opiátov


Číslo patentu: E 7559

Dátum: 19.01.2007

Autor: Hermann Lars

MPK: A61P 25/00, A61K 45/00, A61K 31/485...

Značky: závislých, zneužívania, aspoň, liečenie, prevenciu, neorálneho, morfínu, jedného, použitie, závislosti, opiátov, kombinácie, antagonistu


...drogy. Vzhľadom na slabú vlastnú aktivitu je substancia buprenorfín vhodná ako substitučnýprostriedok len pre časť závislých od opiátov.0012 Vzniká teda potreba iného a zlepšeného liečenia závislosti od drog.0013 Podľa predloženého vynálezu bolo prekvapivo zistené, že kombinácia morñnu a aspoň jedného antagonistu opiátov s biodostupnosťou menšou ako 5 pri orálnom podaní predstavuje vhodný substitučný prostriedok na liečenie závislosti od drog....

Farmaceutické kombinácie antagonistu receptora pre angiotenzín a inhibítora NEP


Číslo patentu: E 16108

Dátum: 08.11.2006

Autori: Sutton Paul Allen, Karpinski Piotr, Liu Yugang, Blacklock Thomas, Feng Lili, Godtfredsen Sven Erik, Hu Bin, Prashad Mahavir, Girgis Michael

MPK: A61K 31/41, A61P 3/10, A61K 31/216...

Značky: farmaceutické, receptora, kombinácie, inhibítora, angiotenzín, antagonistu


...určitých okolností sa skombinovali liečivá srôznymi mechanizmami pôsobenia. Avšak len uváženie akejkoľvek kombinácie liečiv, ktoré majú rôzne režimy pôsobenia, nevedie nutne ku kombináciám s výhodnými účinkami. V súlade s tým existuje potreba účinnej kombinačnej terapie, ktoránemá nepriaznivé vedľajšie účinky.W 0 03/059345 uvádza farmaceutické kombinácie, ktoré obsahujú valsartan alebo jeho farmaceutický prijateľné soli, a inhibítor neutrálnej...

Chrípkové vakcíny obsahujúce kombinácie časticových adjuvancií a imunopotenciátorov


Číslo patentu: E 11359

Dátum: 06.11.2006

Autori: Del Guidice Guiseppe, Rappuoli Rino, O'hagan Derek

MPK: A61K 39/145, A61K 39/39

Značky: obsahujúce, imunopotenciátorov, adjuvancií, chřipkové, kombinácie, částicových, vakcíny


...súpravy obsahujúcu antigén vírusu chrípky a (ii) druhú zložkusúpravy obsahujúcu nerozpustnê časticové adjuvans, kedy buď(a) prvá zložka alebo druhá zložka obsahuje imunopotenciátor,alebo (b) súprava zahŕňa tretiu zložku súpravy obsahujúcuimunopotenciátor, ako je definované v patentových nárokoch.0009 Kompozície podľa vynálezu obsahujú antigén vírusu chrípky. Antigén bude typicky pripravený z chrípkových viriönov, ale ako alternatíva môžu byť...

Nové kombinácie liečiv na liečenie ochorení dýchacích ciest


Číslo patentu: E 8357

Dátum: 06.10.2006

Autori: Pieper Michael, Schnapp Andreas, Bouyssou Thierry

MPK: A61K 31/46, A61K 31/538, A61K 31/40...

Značky: kombinácie, liečiv, ciest, ochorení, dýchacích, nové, liečenie


...dlhodobým účinkom pri súčasnom znížení potenciálu vedľajších účinkov B-mimetika atýmto môžu nájsť použitie pri výrobe liečiva sdlhodobým účinkom amalým profilom vedľajšíchPrekvapujúco sa zistilo, že vyššie uvedené úlohy je možne vyriešiť zlúčeninamiPredložený vynález sa týka nových kombinácií liečiv, ktore okrem ó-hydroxy-S-l-hydroxy-2-2-(4-metoxy-fenyl)-1, 1-dimetyl-etylamino-etyl)-4 H-benzo 1 ,4 oxazin-3-ónu l ako ďalšiu účinnú látku...

Použitie kombinácie zahrnujúcej L-karnitín alebo alkanoyl L-karnitín, benzochinón rozpustný v tukoch a omega-3-polynenasýtenú mastnú kyselinu na prípravu potravinového doplnku alebo lieku na liečbu ochorení rohovky


Číslo patentu: E 14090

Dátum: 30.06.2006

Autori: Gaetani Franco, Feher Janos

MPK: A61K 31/202, A23L 1/30, A61K 31/122...

Značky: omega-3-polynenasýtenú, kombinácie, potravinového, kyselinu, tukoch, alkanoyl, použitie, přípravu, l-karnitín, rozpustný, lieku, ochorení, doplňku, zahrnujúcej, mastnú, rohovky, benzochinón, liečbu


...Path., 2000 4 11-17 Br. J. Ophthalmol., 2005 89 40-44).0014 Ani tieto posledné liečebné postupy, hoci vykazujú pôsobenie, ktoré môže byť považované za relevantnejšie pre liečbu príčin ochorení, nepriniesli očakávané výsledky. 0015 Normálna priehľadnosť rohovky môže byť narušená následkom mnohých ochorení,ktoré poškodzujú jemnú štruktúru rôznych základných zložiek. Najčastejšie spôsobené stavy ochorenia sú poškodenie po keratitíde, najmä po...

Použitie špecifickej kombinácie kopulačného činidla a povlakového činidla ako kopulačného systému (biele plnivo – elastomér) v kaučukových kompozíciách obsahujúcich anorganické plnivo


Číslo patentu: E 17764

Dátum: 19.05.2006

Autori: Guy Laurent, Sterin Sébastien, Fernandez Michel

MPK: C07F 7/18, C08K 5/548

Značky: kaučukových, systému, biele, kopulačného, plnivo, obsahujúcich, elastomér, povlakového, použitie, špecifickej, kompozíciách, anorganické, činidla, kombinácie


...V súčasnosti týka kaučukových matríc na báze izoprénových elastomérov, pri ktorých je, ako je to známe, omnoho obtiažnejšie dosiahnut účinnú väzbu s elastomérom V porovnaní s použitím sadzí.Takto V prípade, že je známe znížiť hysteréziu a teda najmä znížiť vnútomé zahrievanie izoprénových elastomémych výrobkov V priebehu ich použitia anorganickým plnivom, akým je napríklad oxid kremičitý, potom sa to deje na úkor vystuženia kaučukovej...

Kombinácie a spôsoby podávania terapeutických prostriedkov a kombinovanej terapie


Číslo patentu: E 11281

Dátum: 21.02.2006

Autori: Desai Neil, Soon-shiong Patrick

MPK: A61K 31/337, A61K 31/555, A61K 31/7068...

Značky: spôsoby, prostriedkov, terapie, kombinácie, podávania, terapeutických, kombinovanej


...aktivácia mnohých z týchto kináz, napríklad aberanlná aktivita tyrozlnkináz proteínov, napríklad nadexpresiou alebo mutáciou, vedie k nekontrolovanému rastu buniek.Napriklad zvýšená aktivita receptora epidermáíneho rastového faktora (EGFR) bola zistená v nemaíobunkovej rakovine plúc, v rakovine mechúra a rakovine hlavy a krku, a zvýšená aktivita oerbB-Z bola zistená u rakoviny prsníka, vaječnlka, žalúdka a pankreasu. To znamená,...

Kombinácie obsahujúce epotilóny a inhibítor proteín-tyrozínkinázy a ich farmaceutické použitie


Číslo patentu: E 6601

Dátum: 28.11.2005

Autori: Johri Anandhi Ranganathan, Linnartz Ronald Richard, Mcsheehy Paul, Huang Jerry Min-jian

MPK: A61K 31/4353, A61K 31/426, A61K 31/519...

Značky: kombinácie, použitie, proteín-tyrozínkinázy, farmaceutické, obsahujúce, epotilóny, inhibitor


...vo forme farmaceutický prijateľnej soli, na súčasné, spoločné, oddelene alebo sekvenčné použitiepri liečení proliferatívneho ochorenia.Výraz kombinovaný prípravok, ako je tu používaný, definuje zvlášť kit of parts v tom zmysle, že podávanie partnerov (a) a (b), a prípadne (c), v kombinácii ako je definovaná skôr,sa môže uskutočňovať nezávisle alebo s použítím rôznych fixných kombinácií s odlišnými dávkarní partnerovi(a) a (b), a prípadne...

Fungicídne kombinácie účinných látok obsahujúcich fluoxastrobín a boscalid


Číslo patentu: E 14322

Dátum: 11.10.2005

Autori: Suty-heinze Anne, Heinemann Ulrich, Kerz-moehlendick Friedrich, Dutzmann Stefan

MPK: A01N 43/88, A01N 43/40, A01P 3/00...

Značky: látok, boscalid, fungicidně, účinných, kombinácie, obsahujúcich, fluoxastrobín


...pomery medzi zlúčeninou vzorca (I) a niektorou zlúčeninou skupiny (3) sa môžu meniť aj medzi jednotlivými zlúčeninami jednej skupiny.Účinné látky podľa vynálezu majú okrem toho veľmi dobré fungicídne vlastnosti amôžu sa použiť na ničenie fytopatogénnych húb, ako sú plasmodiophoromycetes, oomycetes, chytridiomycetes, zygomycetes,ascomycetes, basidiomycetes, deuteromycetes, atď.Príkladom sú niektori pôvodcovia hubových abakteriálnych...

Inhibítory proteínu podobného angiopoetínu 4, kombinácie a ich použitie


Číslo patentu: E 7068

Dátum: 19.07.2005

Autori: Gerber Hans-peter, Liang Xiao Huan, Ferrara Napoleone

MPK: C07K 16/00

Značky: podobného, inhibitory, použitie, angiopoetínu, kombinácie, proteínu


...vynálezu ANGPTL 4 antagonista je molekula SiRNA. Vjednom uskutočnení SiRNA molekula je ANGPTL 4-SiRNA molekula, kde molekula je zameraná na sekvenciu DNA (napriklad GTGGCCAAGCCTGCCCGAAGA, SEQ lD N 03) nukleovej kyseliny kódujúcej ANGPTL 4.0015 Poskytujú sa spôsoby blokovania alebo redukovania rastu nádoru alebo rastu rakovinových buniek. Vurčitých uskutočneniach spôsoby zahŕňajú podávanie účinného množstva antagonistu podobného...

Použitie farmaceutickej kombinácie na liečenie závislosti od alkoholu


Číslo patentu: 284623

Dátum: 04.07.2005

Autori: Bonhomme Yves, Durbin Philippe, Daoust Martine

MPK: A61P 25/32, A61K 31/485

Značky: farmaceutickej, kombinácie, liečenie, použitie, závislosti, alkoholů

Zhrnutie / Anotácia:

Použitie synergickej kombinácie (i) opioidného antagonistu a (ii) modulátora komplexu receptora NMDA na prípravu farmaceutickej kompozície na liečenie závislosti od alkoholu. Ako opioidný antagonista je výhodne obsiahnutý naltrexon a ako modulátor súboru NMDA receptorov je výhodne obsiahnutý modulátor väzbového miesta spermidínu akamprosát.

Kombinácie obsahujúce antimuskarínové činidlá a beta adrenergné agonisty


Číslo patentu: E 17171

Dátum: 31.05.2005

Autori: Gras Escardo Jordi, Ryder Hamish, Orviz Diaz Pio, Llenas Calvo Jesus

MPK: A61K 31/407, A61K 31/167, A61K 31/439...

Značky: agonisty, činidla, obsahujúce, antimuskarínové, adrenergné, kombinácie


...produkt obsahujúci (a) BZ-agonistu a (b) M 3 antagonistu podľa predloženého vynálezu vo forme kombinovaného prípravku pre súčasné,oddelené alebo sekvenčné použitie na liečbu ľudského alebo zvieracieho pacienta. Typicky sa jedná o produkt pre súčasné, oddelené alebo sekvenčné použitie pri liečení chorôb dýchacieho ústrojenstva ako je astma, akútna alebo chronická bronchitida, emfyzém, chronická obštrukčná choroba pľúc (COPD), bronchiálna...