Zverejnene patenty 19.07.2005

Inhibítory proteínu podobného angiopoetínu 4, kombinácie a ich použitie


Číslo patentu: E 7068

Dátum: 19.07.2005

Autori: Gerber Hans-peter, Liang Xiao Huan, Ferrara Napoleone

MPK: C07K 16/00

Značky: použitie, kombinácie, inhibitory, angiopoetínu, proteínu, podobného


...vynálezu ANGPTL 4 antagonista je molekula SiRNA. Vjednom uskutočnení SiRNA molekula je ANGPTL 4-SiRNA molekula, kde molekula je zameraná na sekvenciu DNA (napriklad GTGGCCAAGCCTGCCCGAAGA, SEQ lD N 03) nukleovej kyseliny kódujúcej ANGPTL 4.0015 Poskytujú sa spôsoby blokovania alebo redukovania rastu nádoru alebo rastu rakovinových buniek. Vurčitých uskutočneniach spôsoby zahŕňajú podávanie účinného množstva antagonistu podobného...

Spôsob a príslušné zariadenie na výrobu dlhých oceliarskych produktov bez prerušenia


Číslo patentu: E 6381

Dátum: 19.07.2005

Autor: Arvedi Giovanni

MPK: B21B 1/46

Značky: zariadenie, příslušné, produktov, oceliarskych, výrobu, dlhých, prerušenia, spôsob


...ohľadne kvality produktu a s ohľadom na možnosti vzniku trhlin na valcovacích valcoch v dôsledku ich ohrevu. Zvýšenie priemernej teploty ako dôsledku vyššej teploty v oblasti jadra umožňuje, aby teplota povrchu bola nižšia ako 1200 °C, atým umožňuje vyhnúť sa vyššie uvedeným problémom.0008 Rovnako tak bolo zistené, že priaznivé účinky tohto typu valcovania spočívajúceho v priamom spojení do linky s kontinuálnym liatím, čiže, inak povedané,...

Farmaceutická kompozícia obsahujúca gabapentín


Číslo patentu: E 12944

Dátum: 19.07.2005

Autori: Grassano Alessandro, Rampoldi Luca, De Lazzari Alessandra

MPK: A61K 31/195, A61K 9/14, A61K 9/48...

Značky: obsahujúca, kompozícia, farmaceutická, gabapentin


...látok schopných nepodporovať konverziu gabapentínu na zodpovedajúce laktámové prímesi,ktorá obsahuje(i) kĺzne činidlo Vybraté z vápenatej soli slabej kyseliny, EP 1 784174 34 326/H(ii) lubrikačné činidlo vybraté zhydrogenovaného ricínového oleja a gIyceroI-behenátu a prípadne(iii) riedidlo, samotné alebo zmiešané s jedným alebo viacerými ďalšími riedidlami, vybraté z monosacharidového cukru, ako je napríklad sorbitol,xylitol, manitol,...

Sulfoaluminátový slinok s vysokým obsahom belitu, spôsob jeho výroby a jeho použitie na prípravu hydraulických spojív


Číslo patentu: E 5998

Dátum: 19.07.2005

Autori: Li Guanshu, Gartner Ellis

MPK: C04B 28/00, C04B 7/00

Značky: spôsob, obsahom, belitu, přípravu, výroby, spojív, slinok, vysokým, sulfoaluminátový, hydraulických, použitie


...hydraulických cementov medzi nimi systémy založené na kalciumalluminátoch (altematívne hlinitan vápenatýyalebo kalciumsulfátoch .Cementy svysokým obsahom hliníka ako Cement Fondu od LAFARGE sú známe z dôvodu ich schopností získať zvýšenú odolnost za krátky čas ale niekedy vytvárajú dobreznámy problém konverzie, ktorý je sprevádzaný prepadom mechanickej odolnosti a navyše ich výroba vyžaduje vysoko špecializované zariadenia, veľkú spotrebu...

Nové fenylaminopyrimidínové deriváty ako inhibítory bcr-abl kinázy


Číslo patentu: E 12672

Dátum: 19.07.2005

Autori: Venkaiah Chowdary Nannapaneni, Adibhatla Kali Satya Bhujanga Rao, Rachakonda Sreenivas, Kompella Amala Kishan, Podili Khadgapathi

MPK: A61K 31/506, A61P 35/02, C07C 233/66...

Značky: deriváty, nové, inhibitory, bcr-abl, fenylaminopyrimidínové, kinázy


...alebo radukálom vzorca H 2 N-CH(R)-C(O)7 NH-, kde R je vodlk, C 1-C 4 alkyl, benzyl. hydroxymetyl, í-hydroxyetyl. merkaptometyl. Z-metyltio-etyl. Indol-S-yl-metyl, fenyl-metyl, t-hydroxy-fenyl-metyl, karbamoyl-metyl,R 2 je C 1-C 6 alkyl. C 1-C 3 alkoxy. chlór, bróm. jód. trifluórrnetyl. hydroxy, fenyl. amino, mono(C 1-C 3 alkyl)amíno, di(C 1-C 3 aIkyl)amino, C 2-C 4 alkanoyl, propenyloxy, karboy. karboxy-metoxy,...

Kompozícia obsahujúca statíny a omega-3 mastné kyseliny


Číslo patentu: E 16575

Dátum: 19.07.2005

Autor: Cavazza Claudio

MPK: A61K 31/122, A61K 31/05, A61K 31/045...

Značky: mastné, kyseliny, obsahujúca, omega-3, statiny, kompozícia


...vynálezu uplatňuje prekvapivý účinok nainzulínovú rezistenciu, ktorý nie je predvídateľný na základe našich poznatkov ojednotlivých zložkách a ich kombinácia V každom prípade vedie k neočakávanćmu synergickému účinku.0018 Pre odbomíkov v odbore je evidentnou výhodou mat takúto kombináciu. Je naozaj možné liečiť inzulínovú rezistenciu a s ňou spojené patologické formy, najmä pokiaľ ide o následky abnonnálneho stavu lipidov a súčasne...

Skľučovadlo na upnutie upevňovacích prvkov na spojenie trecím zváraním


Číslo patentu: E 15784

Dátum: 19.07.2005

Autor: Mauer Dieter

MPK: B23K 20/12

Značky: upevňovacích, upnutie, spojenie, zváraním, prvkov, skľučovadlo, třecím


...neotočné zdvíhadlo, ktoré je axiálne posúvateľné do prstencového upnutia, a ktoré saxiálnym unášaním a rozpojiteľným spôsobom zaberá do prítlačného kusu na jeho strane odvrátenej od upevňovacieho prvku, a že prítlačný kus sa pri dosiahnutí polohy trecieho zvárania upevňovacieho prvku s prstencovým upnutím zablokuje tak, že prstenoové upnutie prenáša na prítlačný kus na seba pôsobiace rotačné sily spoločne s tlakovýmí silami, pričom zdvihadlo...