Patenty so značkou «spôsob»

Strana 164

Spôsob výroby kyseliny jantárovej zo surových hydrolyzátov


Číslo patentu: E 8126

Dátum: 03.05.2004

Autori: Donnelly Mark, Sanville-millard Cynthia, Nghiem Nhuan Phu

MPK: C12P 7/64

Značky: kyseliny, surových, spôsob, hydrolyzátov, jantárovej, výroby


...zväzok 28, 2002, strana 325-332, opisuje spôsob výroby kyseliny jantárovej z média na základe glukózy pri použití mutanta AFP 111 Escherichia coli. Podobný spôsob je taktiež uvedený vo Vemuri a kol. Appl. Environ. Microbiol. april 2002, 68(4) 1715-27.0013 Cieľom tohto vynálezu je poskytnúť spôsob výroby kyseliny jantárovej, ktorý odstraňuje mnohé nedostatky doterajšieho stavu techniky.0014 Ďalším cieľom vynálezu je poskytnúť fermentačný...

2,3-Diarylpyrazolo[1,5-b]pyridazínové zlúčeniny, spôsob ich výroby, farmaceutický prostriedok s ich obsahom a ich použitie


Číslo patentu: 283922

Dátum: 30.04.2004

Autori: Campbell Ian, Mathews Neil, Naylor Alan, Beswick Paul

MPK: C07D 487/04, A61K 31/50

Značky: použitie, výroby, zlúčeniny, 2,3-diarylpyrazolo[1,5-b]pyridazínové, obsahom, prostriedok, farmaceutický, spôsob

Zhrnutie / Anotácia:

Opisujú sa 2,3-diarylpyrazolo[1,5-b]pyridazínové zlúčeniny všeobecného vzorca (I) a ich farmaceuticky prijateľné deriváty, v ktorých R0 znamená halogén, C1-6alkyl, C1-6alkoxy, C1-6alkoxy substituovaný jedným alebo viacerými atómami fluóru, alebo O(CH2)nNR4R5 R1 a R2 sú nezávisle zvolené zo skupiny H, C1-6alkyl, C1-6alkyl substituovaný jedným alebo viacerými atómami fluóru, C1-6alkoxy, C1-6hydroxyalkyl, SC1-6alkyl, C(O)H, C(O)C1-6alkyl,...

Spôsob výroby arylamidov heteroaromatických karboxylových kyselín


Číslo patentu: 283920

Dátum: 30.04.2004

Autori: Kalbermatten Georges, Roduit Jean-paul

MPK: B01J 31/24, C07D 213/81, C07D 239/42...

Značky: heteroaromatických, kyselin, karboxylových, výroby, spôsob, arylamidov

Zhrnutie / Anotácia:

Spôsob výroby arylamidov heteroaromatických karboxylových kyselín všeobecného vzorca (I), kde je každé An dusík alebo CRn (n = 1-5), s pravidlom, že aspoň jeden člen kruhu je dusík a dva atómy dusíka nie sú bezprostredne spolu spojené R1 až R5, pokiaľ sú prítomné, sú nezávisle od seba vodík, C1-4-alkyl alebo aryl, pričom jeden zo substituentov R1 až R5 je skupina vzorca -OR, v ktorej R je prípadne substituovaný aromatický alebo heteroaromatický...

Agregát na veternú energiu cyklónového typu a spôsob získavania energie z neho


Číslo patentu: E 5204

Dátum: 29.04.2004

Autori: Stiig Eric, Golriz Mohammad

MPK: F03D 3/00

Značky: získavania, veternú, agregát, cyklónového, energiu, spôsob, energie


...celej výšky stožiara. Spodná časť stožiara má klín H, čo umožňuje neustály sklon stožiara k vetru a tento klín je horizontálne vsadený v uložení jj v hornej častí podstavca a rotovanie stožiara je hnané motorom(neukázané) a kontrola je automatická tak, že prívod vetra je vždy otočený smerom k vetru. Stožiar teda rotuje okolo vertikálnej osi uloženia Q.Vo vnútri podstavca je generátor 16 vytvorený spolu s hydraulickým motorom,ktorý je...

Palivová zmes pre privádzanie do výfučien pri výrobe surového železa vo vysokej peci a spôsob a zariadenie pre výrobu a privádzanie tejto palivovej zmesi


Číslo patentu: E 11473

Dátum: 28.04.2004

Autori: Hartig Walter, Wulfert Holger, Zewe Horst, Lin Rongshan

MPK: C21B 5/00

Značky: výfučien, železa, vysokej, zariadenie, tejto, spôsob, palivová, výrobe, privádzanie, zmesí, výrobu, palivovej, surového


...a súZo spisu DE 41 04 072 A 1 je známy spôsob recyklácie okují zvalcovania obsahujúcich olej, pri ktorom sa okuje z valcovaniamelú s kamenným uhlím upraveným pre vfukovanie vo vysokýchpeciach, sušia sa a potom sa ako prašné palivo vfukujú do vysokej pece. Opísané palivové zmesi môžu obsahovať kamenné uhlie a okuje obsahujúce olej, alebo oddelene sušené okuje a ropu, alebo okuje,ktoré boli rozdrvené a vysušené s malým množstvom...

Spôsob, systém a sieťový element na autorizáciu prenosu dát


Číslo patentu: E 3313

Dátum: 28.04.2004

Autori: Räisänen Vilho, Hurtta Tujia, Honkasalo Zhi-chun

MPK: H04L 12/56

Značky: spôsob, přenosu, autorizáciu, sieťový, systém, element


...jeden priklad, sa môžu prevádzkovať na úrovni servisného toku. saGGSN a ISN sú v súčasnosti definované v príslušných špecifikáciách. saGGSN umožňuje detekciu úrovne QoS, na hranici siete, pre vybrané služby. S týmito zdokonalenými prvkami jadrovej siete sa môže QoS kontrolovať na báze služieb podľa prístupových bodov service Access point (SAP) , alebo podľa služieb v rámci sAP.0013 Z uvedených príčin je žiaduce poskytnúť zdokonalený...

Spôsob výroby obalu na pastovitý potravinársky výrobok na báze napríklad topeného syra alebo kakaa


Číslo patentu: E 2622

Dátum: 28.04.2004

Autor: Bonnin Yves

MPK: B65D 75/52, B65B 25/00, B65B 3/00...

Značky: obalů, spôsob, potravinářský, báze, topeného, například, pastovitý, kakaa, výroby, výrobok


...ktorý napĺňa jednotlivý ihlanovitý obal.Podľa jednotlivých spôsobov výroby podľa vynálezu film dna ihlanu má obdĺžnikový, štvorcový alebo trojuholníkový tvar.Vynález sa týka tiež obalu na topený syr alebo napr. kakao vyrobené vyššieVynález sa týka tiež obalu na pastovitý potravinársky výrobok, ako je výrobok na báze topeného syra alebo kakaa, ktorý sa vyznačuje tým, že obsahuje časť v tvare ihlanu s otvoreným dnom, ktorá sa vyrába...

Obal na potravinový kašovitý výrobok s trhacím mechanizmom a spôsob jeho výroby


Číslo patentu: E 1469

Dátum: 28.04.2004

Autor: Bonnin Yves

MPK: B65D 3/00, B65B 25/00, B65D 75/52...

Značky: kašovitý, trhacím, výrobok, mechanizmom, potravinový, spôsob, výroby


...etapya) vytvoriť časť obalu v tvare pyramídy, na dne otvorenej, pomocou najmenej jednej rovnej fólie s aspoň jedným trhacim mechanizmom, pripevneným pozdĺž aspoň dvoch strán trojuholníka. Bočnú plochu pyramídy tvori trhací mechanizmus,ktorého roztrhnutie takmer po celej uvedenej ploche podľa predpokladu umožní prístup k výrobku obsiahnutemuv pyramídovom obale, b) umiestniť vrchol obalu do plniacej matrice predstavujúcej takmer rovnaký tvar V...

Nový spôsob a nové medziprodukty na výrobu 17-halogén-19-norsteroidov


Číslo patentu: E 6069

Dátum: 27.04.2004

Autori: Moratille Christian, Nique François, Bousquet Joelle, Roussel Patrick

MPK: C07J 21/00, C07J 75/00, C07J 43/00...

Značky: spôsob, 17-halogén-19-norsteroidov, nové, výrobu, medziprodukty, nový


...X znamená atóm halogénu, c) zlúčenina vzorca IV sa podrobí účinku epoxidačného činidla, aby sa získala zlúčeninad) zlúčenina vzorca V sa podrobí alkylačnej reakcii s organokupràtovým derivátomodvodeným od organokovovej zlúčeniny vzorca RgMgHal alebo R 5 Li, pričom Hal znamenáatóm halogénu, a pripraveným katalytickým alebo stechiometrickým spôsobom, a v ktoromV ktorej n, R a R 2 majú významy definované skôr, pričom dôjde k väzbe na úrovni...

Pyrazol-chinazolínové deriváty, spôsob ich prípravy a ich použitie ako inhibítorov kinázy


Číslo patentu: E 15465

Dátum: 27.04.2004

Autori: Vianello Paola, Vulpetti Anna, Pevarello Paolo, Quartieri Francesca, Ferguson Ron, Traquandi Gabriella, Roletto Fulvia, Brasca Maria Gabriella, Panzeri Achille, Polucci Paolo, Fancelli Daniele, D'alessio Roberto

MPK: A61K 31/519, A61P 35/00, C07D 487/04...

Značky: kinázy, deriváty, použitie, inhibítorov, spôsob, pyrazol-chinazolínové, přípravy


...vaskulárnych hladkých buniek spájaných s aterosklerózou, pľúcnej tibrózy, artritídy,glomerulonetřitídy a post-chirurgickej stenózy a rcstenózy.0014 Zlúčeniny podľa vynálezu môžu byť užitočné pri liečení Alzheimerovej choroby, a to na základe skutočnosti, že cdk 5 je zapojená do fosforylácie tau proteínu (J. Biochem. ll 7, 741-749, l 995).0015 Zlúčeniny podľa tohto vynálezu ako modulátory apoptózy môžu byť tiež užitočné pri liečbe zhubného...

Substituované deriváty 1,2,3,4-tetrahydronaftalénu, spôsob ich prípravy, medziprodukty na ich prípravu, farmaceutické prípravky s ich obsahom a ich použitie


Číslo patentu: 283918

Dátum: 27.04.2004

Autori: Thorberg Seth-olov, Ross Svante, Berg Stefan, Linderberg Mats, Ulff Bengt

MPK: A61K 31/445, C07C 237/24, A61K 31/495...

Značky: medziprodukty, farmaceutické, spôsob, obsahom, 1,2,3,4-tetrahydronaftalénu, použitie, přípravky, přípravy, přípravu, deriváty, substituované

Zhrnutie / Anotácia:

Opisujú sa deriváty piperidyl- alebo piperazinyl- substituovaného-1,2,3,4-tetrahydronaftalénu všeobecného vzorca (I), v ktorom X znamená N alebo CH Y predstavuje NR2CH2, CH2-NR2, NR2-CO, CO-NR2 alebo NR2SO2, kde R2 znamená H alebo C1-C6-alkyl R1 predstavuje H, C1-C6-alkyl alebo C3-C6-cykloalkyl R3 znamená C1-C6-alkyl, C3-C6-cykloalkyl alebo (CH2)n-aryl, kde arylom je fenyl alebo heteroaromatický kruh obsahujúci jeden alebo dva heteroatómy...

Obal vybavený kupónom a spôsob jeho vyhotovenia


Číslo patentu: 283916

Dátum: 27.04.2004

Autori: Tallier Bernard, Fiems Jean-pierre

MPK: B65D 85/10

Značky: vybavený, vyhotovenia, kupónom, spôsob

Zhrnutie / Anotácia:

Obal (2) je vybavený hlavne prostriedkom otvorenia (20), napr. odtrhávacou páskou, ktorá po odtrhnutí umožní užívateľovi prístup do obalu a k predmetom v ňom obsiahnutým. Kupón (3) obsahujúci verejné, napr. reklamné informácie, je pripevnený na jednu stenu zabalenej škatuľky. Kupón je tiež vybavený prostriedkom (31) otvorenia, ktorý umožní prístup k informáciám na vnútorných stranách kupónu. Prostriedok (31) otvorenia kupónu je umiestnený v tej...

Spôsob priebežnej výroby spojených minerálnych vláknitých dosiek a zariadenie na vykonávanie tohto spôsobu


Číslo patentu: 283915

Dátum: 27.04.2004

Autori: Zimmerman Fredy, Jacobsen Bent, Wyss Peter

MPK: D04H 1/70

Značky: spôsobu, zariadenie, tohto, spôsob, vláknitých, dosiek, minerálnych, spojených, výroby, priebežnej, vykonávanie

Zhrnutie / Anotácia:

Vláknité rúno sa transportnými prostriedkami dopravuje do predbežného stlačovacieho stupňa (17), kde sa hrúbkovo stláča, ďalej postupuje do pozdĺžnej stlačovacej jednotky (19, 19') rúna, ktorá je usporiadaná za predbežným stlačovacím stupňom (17) na hĺbkové stlačovanie rúna a do vytvrdzovacej pece (25) na prepojenie pozdĺžne stlačovaného rúna. Medzi stlačovacou jednotkou (19, 19') a vytvrdzovacou pecou (25) sú prostriedky na zabránenie...

Spôsob výroby čistých roztokov alkalických hlinitanov


Číslo patentu: 283913

Dátum: 27.04.2004

Autori: Sedelies Reinhold, Roggenkamp Detlev, Potencsik Istvan, Dörrer Hubert, Breker Johannes

MPK: C01F 7/47

Značky: alkalických, čistých, hlinitanov, spôsob, roztokov, výroby

Zhrnutie / Anotácia:

Spôsob niekoľkostupňového čistenia a koncentrácie roztokov alkalických hlinitanov, ktoré sú odpadom v priemysle spracovania hliníka, kalov, filtračných koláčov a pevných zvyškových látok obsahujúcich hliník, za získania roztokov alkalických hlinitanov alebo pevných alkalických hlinitanov. Spôsob sa uskutočňuje tak, že sa nastavuje mólový pomer alkalického oxidu k oxidu hlinitému prísadou alkalického lúhu a/alebo oxidu hlinitého na 1 až 5, s...

Spôsob prípravy molekulárnych komplexov


Číslo patentu: E 12147

Dátum: 23.04.2004

Autori: Freiss Bernard, Lochard Hubert, Sauceau Martial

MPK: A61K 9/16, A61K 47/48, A61K 9/14...

Značky: spôsob, přípravy, komplexov, molekulárnych


...zachováva svoju pôvodnúštruktúru, čo neumožňuje vylepšenie jej biodostupnosti.0009 V patentovej prihláške FR 2798863 Perut a Majewski je aktívna látka (kava-kava (piepor opojný), kurkuma, zmes čierneho korenia a sladkej papriky) vopred extrahovaná superkritickoukvapalinou a precipitovaná V autokláve, ktorý obsahuje porézny nosič. Poréznym materiálom je maltodextrín. Autori nárokujúspôsob adsorpcie aktívnej látky na poréznu látku a nie...

Spôsob výroby ráfikov kolies z ľahkých zliatin a ráfiky vyrobené týmto spôsobom


Číslo patentu: E 3538

Dátum: 23.04.2004

Autor: Afeltra Umberto

MPK: B21D 53/26, B60B 21/00, B60B 3/00...

Značky: ráfiky, týmto, spôsob, zliatin, spôsobom, výroby, kolies, vyrobené, ľahkých, ráfikov


...2-19.0015 Ďalším cieľom predloženého Vynálezu je ráfik kolesa z ľahkých zliatin, ako je opísané V pripojenom patentovom nároku 20.0016 Ďalšie vlastnosti a výhody Vynálezu budú lepšie pochopenéz nasledujúceho podrobného opisu jeho výhodného uskutočnenia, ktoré je uvedené ako neobmedzujúci príklad, vzťahujúci sa k pripojeným obrázkom, kde- obrázok 1 znázorňuje perspektívny pohľad na ráfik kolesa z ľahkých zliatin pre automobil- obrázok 2...

Soli clopidogrelu a spôsob ich použitia


Číslo patentu: E 18237

Dátum: 22.04.2004

Autori: Lohray Vidya Bhushan, Dave Mayank, Lohray Braj Bhushan

MPK: C07D 495/04

Značky: clopidogrelu, použitia, spôsob


...levorotačný enantiomér vzorca (I) sa z týchto dvoch enantiomérov menej toleruje a je menej aktívny. US Patent No. 4,847,265 tiež opisuje rôzne iné soli zlúčeniny vzorca (I), ako jeho hydrochlorid, soli karboxylovej kyseliny a kyseliny sulfónovej. Konkrétne sa pripravili soli kyseliny octovej, benzoovej,fumárovej, maleínovej, citrónovej, tartárovej, gentisovej,metánsulfónovej, etánsulfónovej, benzénsulfónovej a laurylsulfónovej. Avšak...

Spôsob spracovania vyhnitého kalu


Číslo patentu: E 6395

Dátum: 22.04.2004

Autori: Pettersson Lennart, Recktenwald Michael, Karlsson Göran, Karlsson Ingemar

MPK: C02F 11/06, C02F 11/14

Značky: spracovania, vyhnitého, spôsob


...zakázané ukladanie všetkých organických odpadových látok na miestach pre skládku odpadov.0007 Vzhľadom k vyššie uvedenému je potrebné aby vyhnitý kal, ktorý je určený na spaľovanie, obsahoval čo najväčšie množstvo pevných látok. Rovnako v prípade iných typov finálneho skladovania odvodneného kalu ako je kal určený na spaľovanie je veľmi dôležité, okrem iného aj z ekonomických dôvodov, aby sa znížilo množstvo kalu jeho odvodnením na čo...

Spôsob výroby natieraného papiera s perleťovým efektom


Číslo patentu: E 7122

Dátum: 21.04.2004

Autor: Fedrigoni Giuseppe

MPK: D21H 19/00, D21H 23/00, D21H 27/18...

Značky: efektom, perleťovým, natieraného, spôsob, papiera, výroby


...a výhody predloženého vynálezu budú lepšie zrejmé zpredloženého podrobného opisu niektorých súčasne uprednostňovaných príkladov uskutočnenia, predstavených neobmedzujúcim príkladom, s odvolaním sa na pripojené výkresy, v ktorýchNa obrázku l je natieraný papier s perleťovým efektom podľa predloženého vynálezuv perspektívnom pohľade Na obrázku 2 je nanášací valec v perspektívnom pohľadeNa obrázku 3 je pohľad na bokorys vo zväčšenom...

Stereoselektívny spôsob prípravy klopidogrelu


Číslo patentu: E 4312

Dátum: 20.04.2004

Autori: Štohandl Jiří, Ness Winfried, Frantisek Jaroslav

MPK: C07C 209/00, C07C 211/00, C07D 333/00...

Značky: stereoselektívny, spôsob, klopidogrelu, přípravy


...aktívny aminoalkohol (R)-dimepranol je síce dostupný komerčne, podľa vynálezu sa Však objavil spôsob,ktorým sa opticky aktívny aminoalkohol môže ľahko a s nízkymi nákladmi vyrábať z racemického aminoalkoholu. Na to sa 0,5 ekvivalentu kyseliny díbenzoyl-L-vínnej rozpustí s jedným ekvivalentom racemického alkoholu vo vhodnom rozpúštadle, ako napríklad C 1-C 4-alkanole, najmä V etanole. Pri tom vzniká príslušný derivát...

Zariadenie prenosu tepla pre veľkoobjemové vnútorné priestory vozidiel a spôsob prevádzky zariadenia prenosu tepla


Číslo patentu: E 1088

Dátum: 20.04.2004

Autor: Scheid Helmut

MPK: B60H 1/00

Značky: prevádzky, zariadenia, přenosu, vnútorné, tepla, velkoobjemové, vozidiel, spôsob, zariadenie, priestory


...teplonosné médium s príslušným prípravkom. To zníži zvislýzastavaný priestor zariadenia prenosu tepla a celkovú hmotnosťjednotky.Zariadenie prenosu tepla podľa vynálezu je hlavne ďalej rozvinute výhodne tým, že skriňa máhomú stenu skrine a spodnú stenu skrine, že kanál teplonosného médiaje integrovaný do homejsteny skrine a hlavne tiež do spodnej steny skrine, a že vzduchove kanály prenosu tepla sú usporiadané medzi vzduchovým vstupným...

Spôsob a bezpečnostné zariadenie na zapojenie zemnej ochrany


Číslo patentu: E 1267

Dátum: 19.04.2004

Autor: Zandonella Balco Sandro

MPK: H02H 3/32

Značky: bezpečnostné, spôsob, zemnej, zariadenie, ochrany, zapojenie


...počet citlivých ochranných zapojení, schopných vloženia do zástrčky pre napájanie z elektrickej siete. V tomto prípade môžu byť realizované zariadenia citlivé na prúdy až do 3 mA, alebo dokonca menšie.Nebezpečná úroveň prúdu závisí od rôznych elementov a štandardov pre elektrolekárske aplikácie, kde sú elektródy v kontakte s pacientom, pričom pre ochranný obvod je vyžadovaná maximálna medza 3 mA avšak nebezpečné môžu byt prúdy pod 1 mA, ak...

Spôsob a zariadenie na kontinuálne sušenie materiálu, najmä čistiarenskeho kalu


Číslo patentu: E 19369

Dátum: 19.04.2004

Autor: Vonplon Armin

MPK: F26B 1/00, F26B 25/00, F26B 17/04...

Značky: spôsob, sušenie, najmä, kontinuálně, zariadenie, čistiarenskeho, materiálů


...sušiaceho plynu.0009 Keď sú prívodné vedenia navzájom spojené nastaviteľnými tiahlami, môže byt sušiaci kryt skonštruovaný zvlášť jednoducho a môže byť upravenýpre optimálne utesnenie vzhľadom k nosnej konštrukcii sušiarne.0010 U veľkokapacitných sušiarni je cenovo výhodné vytvorit spodnú čast sušiarne alebo celý plášť sušiarne z betónu.0011 Ked sa kvôli ochrane životného prostredia necháva brida skondenzovat alebo sa následne upravuje v...

Spôsob tvarovania telies nádobiek a príslušné zariadenie


Číslo patentu: E 2782

Dátum: 16.04.2004

Autori: Druesne Guy, Verboom Cornelis

MPK: B21D 51/26, B21D 26/00

Značky: nádobiek, zariadenie, příslušné, tvarovania, telies, spôsob


...a stlačovacie prostriedky, pričom kompresné a dekompresne prostriedky sú prispôsobené na uchovávanie0009 V patentovom spise EP 0 521 637 je opísane zariadenie a spôsob na pretvarovávanie nádobiek s dvojitým švíkom Zariadenie obsahuje formu, prostriedky na utesnenieotvoreného konca nádobky, prostriedky na privádzanie tekutinypod tlakom do vnútrajšku nádobky, a prídržné prostriedky na zabránenie deformácie dvojitého švika počas...

Usporiadanie odporov, spôsob výroby a merací obvod


Číslo patentu: E 1260

Dátum: 16.04.2004

Autor: Hetzler Ullrich

MPK: H01C 1/00, H01C 1/14, G01R 19/00...

Značky: usporiadanie, výroby, obvod, spôsob, odporov, merací


...navzájom oddelenýchodporových elementov, ktoré môžu viest vždy jeden elektrickýVo výhodných prikladných uskutočneniach vynálezuobsahuje usporiadanie odporov podľa vynálezu dva od sebanavzájom oddelené odporové elementy, takže súčasne môžu bytmerané dva elektrické prúdy.V rámci vynálezu je ale tiež možné, aby usporiadanie odporov obsahovalo viac ako dva (napríklad štyri) od seba navzájom oddelené odporové el ementy , aby bolo možné me...

Spôsob prípravy N-substituovaných 2-kyanopyrolidínov


Číslo patentu: E 18249

Dátum: 15.04.2004

Autori: Schäfer Frank, Sedelmeier Gottfried

MPK: C07D 207/16, A61K 31/401, A61P 3/10...

Značky: 2-kyanopyrolidínov, n-substituovaných, přípravy, spôsob

Text: arylovou skupinou fenyl alebo substituovaný fenyl.V prípade, že X je -O-SO 2-(C 1.g)alkyl alebo -O-SOg-(aryl), potom sa termín alkyl vzťahuje na bud priamy alebo rozvetvený reťazec, ktorý môže byť prípadne substituovaný l až 5 substituentmi vybranými z halogénu výhodne z fluóru, chlóru, brómu alebo jódu. Príklady alkylových skupín zahŕňajú metyl, etyl, propyl, izopropyl, n-butyl, t-butyl, izobutyl, trifluórmetyl.Vo vyššie opísanom spôsobe...

Spôsob výroby škatuľky s odklopným viečkom


Číslo patentu: E 1747

Dátum: 15.04.2004

Autori: Wentao Lu, Katajamäki Seppo

MPK: B65D 85/08

Značky: výroby, odklopným, škatuľky, spôsob, viečkom


...bočných stien a bočných stien viečka tak, že vonkajšie jazýčky a bočné jazýčky viečka sú spojené navzájom úzkymi spojenými pásikmi lepidla,prechádzajúcimi v pozdĺžnom smere uvedených jazýčkov prednostne V každom prípade dvomi rovnobežnými pásikmi lepidla. Lepenieviečkovej časti je vykonávané s použitím lepidlových bodov.Boli tiež opísané lepidlové body podľa predchádzajúceho stavu techniky, ktoré sú usporiadané V oblasti prednej steny...

Spôsob prípravy gabapentínu bez aniónov anorganických kyselín


Číslo patentu: E 13726

Dátum: 14.04.2004

Autori: Assanelli Cinzia, Breviglieri Gabriele, Contrini Sergio

MPK: C07C 227/42, C07C 227/40, C07C 229/28...

Značky: gabapentínu, kyselin, spôsob, přípravy, aniónov, anorganických


...pri 50 °C. výťažok je približne 90 teoreticky,s testom vyšší ako 99,5 . Výsledná soľje suspendovaná v čistom etanole v množstvách 3 - 5 litrov na kg soli pri teplote 15 - 25 °C a k suspenzii sa pridá určité množstvo terciálneho amínu (výhodne tributylacnin a najvýhodnejšie N-etyl-diizopropropylamín (Hünigova zásada) v množstvách 1 - 1,2 mólov na mól hydroxybenzoátu gabapentínu. Po miešani po dobu niekoľkých hodín pri tej istej teplote sa...

Spôsob výroby spojovacích systémov a spojovacie systémy vyrobené týmto spôsobom


Číslo patentu: E 2639

Dátum: 14.04.2004

Autori: Blanc Jérôme, Legat Jean-jacques

MPK: B29C 45/00, F16B 19/04, B29C 45/16...

Značky: spôsob, spôsobom, týmto, spojovacích, výroby, vyrobené, spojovacie, systémov, systémy


...pomocoudorazov a zarážok obmedzí možnost čapovým dielom ľubovoľne otáčať.0011 Vynález sa podrobnejšie opisuje pomocou príkladov a pripojených výkresov, ktoré znázorňujú VObr.1 perspektívne vyobrazenie prvého spojovacieho systému podľa predmetného vynálezu, Obr.2 perspektívne vyobrazenie upevňovacieho dielu spojovacieho systému podľa obr. 1, Obr. 3 pohľad na širšiu stranu upevňovacieho dielu podľa obr. 2,Obr. 4 pohľad na užšiu stranu...

Spôsob na zabránenie doručenia nevyžiadanej pošty v službe odosielania krátkych správ


Číslo patentu: E 19536

Dátum: 14.04.2004

Autor: Nooren Eloy Johan Lambertus

MPK: H04L 12/58, H04W 88/18

Značky: doručenia, nevyžiadanej, správ, odosielania, krátkých, zabránenie, pošty, službe, spôsob


...ovládať doručenie správySMS do mobilného terminálu. Je potrebné uznať, že prevod druhých smerovacích údajov na prvé smerovacie údaje by sa mal vykladať extenzívne, t.j. je potrebné len to, aby bolo možné nájsť prvé smerovacie údaje, keď sú prijaté alebo známe druhé smerovacie údaje. Ďalej je potrebné uznať, že výraz sieťový prvok by sa mal vykladať extenzívne, pričom môže zahŕňať niekoľko komponentov alebo aplikácií,cez ktorý je...

Spôsob prípravy dialkyl-3-oxoglutarátov


Číslo patentu: E 5230

Dátum: 13.04.2004

Autori: Morasz Tamás, Töreki József, Jákfalvi Elemér, Gregorné Boros Livia, Szabo Attila, Tóth Gábor, Olah Sándor

MPK: C07C 69/00, C07C 67/00

Značky: spôsob, dialkyl-3-oxoglutarátov, přípravy


...ktorá sa uskutoční s použitím zriedenej kyseliny chlorovodíkovej.0010 Nevýhoda vyššie uvedených dvoch metód spočíva v tom, že sa pri nich používajúureakčné činidlá a sú vyžadované reakčné teploty (reakcia s lítiumdiizoipropylamidom sa uskutočňuje pri teplote -45 °C, a na druhej strane použitie amidu sodného a kvapalného amoniaku), ktoré vyžadujú zvláštne zaobchádzanie nevhodné pre výrobu v priemyselnom meradle (ako je napríklad dokonalá...

Spôsob prípravy N-terminálom modifikovaných chemotaktických faktorov


Číslo patentu: E 3895

Dátum: 13.04.2004

Autori: Lenter Martin, Doods Henri, Necina Roman, Seidler Randolph, Wandl Robert

MPK: A61P 9/00, A61K 38/19, C07K 14/435...

Značky: faktorov, n-terminálom, modifikovaných, přípravy, chemotaktických, spôsob


...MCP-l proteínu izolovaného zprírodného zdroja je N-koniec blokovaný. Ako sa zístilo neskôr, toto naznačuje na posttranslačnú modiñkáciu, pri ktorej sa glutmnín, uvoľnený po odštiepenícagttcaatg atttgaatga cttcctggct atgctttcatccccatcctc tcacccccct cagatttaac ctćtccccct gagaccaacc aaagtctctg Ctcgctcagc gttatcatgg caagataagg gcagagcctg atccagctct gatcagggta cagaatctgg tgagtatcag gtggggctcc gacacttgta ttatataccc ctctgaggta ttttgttttt...

Spôsob prípravy 4,10beta-diacetoxy-2alfa-benzoyloxy-5beta,20-epoxy-1,13alfa-dihydroxy- 9-oxo-19-norcyklopropa[g]tax-11-enu


Číslo patentu: E 3454

Dátum: 13.04.2004

Autori: Didier Eric, Amouret Guy

MPK: C07D 305/00

Značky: 9-oxo-19-norcyklopropa[g]tax-11-enu, spôsob, přípravy, 4,10beta-diacetoxy-2alfa-benzoyloxy-5beta,20-epoxy-1,13alfa-dihydroxy


...vyššie uvedených troch patentoch je zlepšený použitím sulfolánu.0011 Zlúčenina nasledujúceho vzorca (I)Ar znamená radikál aryl, R znamená atóm vodíka alebo acetylový, alkoxyacetylový alebo alkylový radikál, R 1 znamená benzoylový radikál alebo radikál R 2-O-CO-, v ktorom R 2 znamená priamyalebo rozvetvený alkylový radikál obsahujúci 1 až 8 atómov uhlíka, sa pripraví spôsobomspočívajúcom v uvedení zlúčeniny vzorca (II)V ktorom R znamená...

Spôsob zhodnotenia ťažkých surovín odasfaltovaním a hydrokrakovaním na ebulovanom lôžku


Číslo patentu: E 3266

Dátum: 13.04.2004

Autori: Kressmann Stéphane, Gueret Christophe, Verstraete Jan

MPK: C10G 69/00

Značky: odasfaltovaním, spôsob, lôžku, ťažkých, surovin, hydrokrakováním, ebulovanom, zhodnotenia


...spracovanie alebo vyžadujúce iba mierne dodatočné spracovanie.0010 Tento vynález sa teda zameriava na spôsob spracovania suroviny uhľovodíkov, z ktorých minimálne 95 hmotn. sú tvorené zlúčeninami, ktoré majú teplotu varu aspoň 340 C, ktorý je charakteristický tým, že obsahujea) sa spája surovina srozpúšťadlom tak, aby sa získal odasfaltovaný nástrek, ktorý má obsah asfalténov (nerozpustných v n-heptáne podla normy NF-T-60-115) nižší ako...

Spôsob a forma na výrobu ozubených remeňov na prenos sily


Číslo patentu: E 2733

Dátum: 13.04.2004

Autori: Wegele Brian Dean, Song Tao, Lederer Steven Andrew

MPK: F16G 5/00, B29D 29/00

Značky: ozubených, spôsob, výrobu, remeňov, prenos, forma


...meniť na základe obvodovej dĺžky remeňa Až doposiaľ bola na výrobu remeňa danej obvodovej dĺžky požadovaná špecifická, jednoúčelová fonna, umožňujúca potrebný optimalizovaný sled rozstupov. Pretože vytvorenie špecifickej formy prekaždú dĺžku remeňa je cenovo nedostupné, bola priemyselná prax pomalé pri prijímaní techník na znižovanie hluku vdezéne a sledu zubov vremeňoch rôznych dĺžok. Kým sa táto prax nevyvaruje nákladného rozširovania...

Spôsob kryštalizácie guanidínových solí


Číslo patentu: E 4318

Dátum: 10.04.2004

Autori: Lippert Ricky, Bensinger Dieter, Haas Alexander, Bartmann Ekkehard, Kirschbaum Michael

MPK: C07C 277/00, C07C 315/00, C07C 279/00...

Značky: spôsob, guanidinových, kryštalizácie, solí


...ktoré sú vhodné zvlášť na liečeniearytmií, ku ktorým dochádza v dôsledku nedostatku kyslíka.0004 Tieto zlúčeniny vykazujú dobrý kardioprotektívny účinok a sú vhodné predovšetkým na liečbu akútneho infarktu myokardu, profylaxie infarktu, poinfarktovej liečbe, liečbe srdcovej insuficiencie a angíny pektoris. Ďalej pôsobia proti všetkým patologickým hypoxickým a ischemickým poškodeniam,takže môžu byt liečené primárne alebo sekundárne...

Spôsob glykopegylácie a proteíny/peptidy tvorené týmito spôsobmi


Číslo patentu: E 10747

Dátum: 09.04.2004

Autori: Zopf David, Hakes David, Bowe Caryn, Chen Xi, Bayer Robert, De Frees Shawn

MPK: A01N 43/04

Značky: týmito, spôsobmi, glykopegylácie, tvorené, spôsob

Text: prirodzene sa vyskytujúcej forme peptidu. Väčšina peptidov tvorených rekombinantnýmiprostriedkami obsahuje glykánové štruktúry, ktoré sú odlišné od prirodzene sa vyskytujúcich glykánov.0006 Vodbore bol navrhnutý celý rad metód pre prispôsobenie glykozylačného proñlu peptidu vrátane tých opísaných vo W 0 99/22764, W 0 98/58964, W 0 99/54342 a patentu Spojených štátov č. 5 047 335, okrem iných. V podstate bolo klonovaných a...

Spôsob a zariadenie na usporiadanie komponentov plazmového oblúkového horáka


Číslo patentu: E 8544

Dátum: 09.04.2004

Autori: Shipulski Edward, Jones Casey, Brandt Aaron, Lindsay Jon, Currier Brian, Duan Zheng, Anderson Richard

MPK: H05H 1/28, H05H 1/34

Značky: oblúkového, usporiadanie, zariadenie, plazmového, komponentov, spôsob, horáka


...konca, obklopujúcej vloženú A chladiacu vstupnú rúrku obsahujúcu duté, tenkostenné valcoveteleso vymedzujúce valcový priechod prechádzajúci telesom a jeumiestnené v susedstve duteho vnútorného povrchu tela elektródy. Rúrka vystupuje do vybratia V odstupe, aby poskytla vysokúrýchlosť prúdenia chladiva cez vnútorný povrch elektródy.0007 US 2001/007320 opisuje plazmový oblúkový horák so zlepšeným tesnením spojov medzi tekutinovými...

Spôsob liečenia Parkinsonovej choroby


Číslo patentu: E 6102

Dátum: 08.04.2004

Autori: Cattaneo Carlo, Salvati Patricia, Benatti Luca, Ruggero Fariello

MPK: A61P 25/00, A61K 31/16

Značky: choroby, liečenia, spôsob, parkinsonovej


...terapia obsahuje sañnamid, amantidin, jedno alebo viac liečiv z levodopa/Půls, ako sú levodopa plus karbidopa (SlNEMET®), levodopa plus karbidopa sriadeným uvoľňovaním (SINEMET-CR®), levodopa plus benzerazid (MADOPAR®), a levodopa plus benzerazid s riadeným uvoľňovaním (MADOPAR-HBS), jeden alebo viac zo skupiny entakapon a tolkapón, ajeden alebo viac zo skupiny bromokriptín, kabergolin, lizurid, pergolid, ropinirol, apomorñn,...

Spôsob liečby Parkinsonovej choroby


Číslo patentu: E 15918

Dátum: 08.04.2004

Autori: Ruggero Fariello, Benatti Luca, Salvati Patricia, Cattaneo Carlo

MPK: A61K 31/16, A61P 25/16

Značky: choroby, liečby, parkinsonovej, spôsob


...každé terapeutické činidlo je podávané v odlišnom čase, ako aj podávanie týchto terapeutických činidiel alebo najmenej dvoch z týchto terapeutických činidieí v podstate súbežným spôsobom. V podstate súbežne podávanie sa môže uskutočniť napríklad podávaním subjektu jednej kapsuly obsahujúcej všetky terapeutické činidlá vo ñxnom pomere alebo podávaním viacerých samostatných tabliet každého terapeutickeho činidla. Postupne alebo v podstate...