Patenty so značkou «rekombinantné»

Gén izolovaný z Corynebacterium glutamicum, rekombinantné koryneformné baktérie a spôsob produkcie L-lyzínu alebo L-treonínu

Načítavanie...

Číslo patentu: 287997

Dátum: 27.08.2012

Autori: Mccormack Ashling, Moritz Bernd, Eggeling Lothar, Sahm Hermann, Thierbach Georg, Burke Kevin, Dunican Kieran (zomrel), Möckel Bettina, Stapelton Cliona

MPK: C12N 15/77, C12P 13/08, C12N 15/53...

Značky: koryneformné, l-treonínu, l-lyzínu, izolovaný, rekombinantné, corynebacterium, glutamicum, spôsob, bakterie, produkcie

Zhrnutie / Anotácia:

Gén izolovaný z Corynebacterium glutamicum, označovaný ako gén zwf, pripraviteľný z C. glutamicum ATCC 13032 pomocou PCR s použitím nasledujúceho olígonukleotídového priméru: zwf-dopredný, SEQ ID č.: 10: 5'-TCG ACG CGG TTC TGG AGC AG-3', zwf-reverzný, SEQ ID č.: 11: 5'-CTA AAT TAT GGC CTG CGC CAG -3' a kódujúci polypeptid, ktorý vykazuje aktivitu glukóza-6-fosfát-dehydrogenázy, pričom tento polypeptid obsahuje N-koncovú aminokyselinovú...

Lyofilizované rekombinantné VWF prípravky

Načítavanie...

Číslo patentu: E 14174

Dátum: 21.10.2009

Autori: Turecek Peter, Schnecker Kurt, Haidweger Eva

MPK: A61K 38/16, A61K 47/12, A61K 38/36...

Značky: rekombinantné, lyofilizované, přípravky

Text:

...HEPES, Tris a kombinácie týchto látok. V ďalšom uskutočnení bol ako tlmivý prostriedok použitý citrát. V rôznych uskutočneniach bolo pH v rozsahu od približne 6,0 do približne 8,0, od približne 6,5 do približne 7,5 alebo okolo 7,3. V inom uskutočnení bolo pH približne 7,3.0011 Vinom uskutočnení hore uvedená aminokyselina bola vybraná zo skupinykoncentrácia aminokyseliny bola v rozpätí od približne 0,5 mM do približne 300 mM. V ešteinom...

Stabilizované kompozície pre rekombinantne produkovaný faktor VIII

Načítavanie...

Číslo patentu: E 12318

Dátum: 03.09.2009

Autori: Agerkvist Iréne, Nilsson Ulrika, Ivarsson Elsa, Österberg Josefin, Rippner Brita

MPK: A61K 31/195, A61K 38/37, A61K 9/19...

Značky: produkovaný, kompozície, rekombinantné, faktor, stabilizované

Text:

...cmc polyoxyetylén obsahujúcich neiónových detergentov sú teplotne závislé tak, že sa hodnota cmc zvyšuje v nižších teplotách (Alexandridis, P. et al, 1994. Nilsson, M. et al, 2007). Hodnota cmc Poloxameru 188 je aspoň 20-30 mg/ml ve 37 °C (Kabanov, A. V. et al, 1995, 3Alexandrídis, P. et al, 1994, Moghimi, S. M. et al, 2004) a zvyšuje sa na 100 mg/ml v 20 °C (Nakashíma, K. et al, 1994). Podľa týchto publikácii je teda cmc Poloxameru 188 je v...

Rekombinantné bunky produkujúce omega-aminokarboxylové kyseliny, estery omega-aminokarboxylových kyselín alebo ich laktámy

Načítavanie...

Číslo patentu: E 18690

Dátum: 12.12.2008

Autori: Blank Lars, Schmid Andreas, Haas Thomas, Weckbecker Andrea, Bühler Bruno, Sieber Volker, Welters Peter, Schullehner Katrin, Eggert Thorsten, Häger Harald, Müller Andreas, Karau Andreas, Jach Guido, Lalla Bernd, Grammann Katrin

MPK: C08G 69/08, C08G 69/14, C12N 15/09...

Značky: buňky, rekombinantné, omega-aminokarboxylových, laktamy, produkújuce, omega-aminokarboxylové, kyselin, estery, kyseliny

Text:

...riešeniu vyššie uvedených úloh prispieva bunka, ktorá je v porovnaní s jej divým typom geneticky modifikované tak, že v porovnaní s jej divým typom je schopná zkarboxylových kyselín alebo esterov karboxylových kyselín produkovať viac(o-aminokarboxylových kyselín, viac esterov co-aminokarboxylových kyselín alebo viac laktámov odvodených z w-aminokarboxylových kyselín, pričom bunka vykazuje aktivituenzýmov E 1 a Em alebo enzýmov E 1, En a Em...

Rekombinantne modifikovaný plazmín

Načítavanie...

Číslo patentu: E 18413

Dátum: 25.11.2008

Autor: Novokhatny Valery

MPK: C12N 9/68, C12N 15/09

Značky: modifikovaný, rekombinantné, plazmín

Text:

...rekombinantný proteín, ktorý disponuje požadovanými vlastnosťami (napr. oblasti chemickej štruktúry, ktoré sú nativne) plazmínu/plazminogénu, nemá niektoré negatívne vlastností a je schopný produkcie v expresných systémoch pre rekombinantné proteíny, vrátane bakteriálnych buniek vo0008 Vpatentovej prihláške PCT W 0 2007/047874 A je opísaný delta-plazmínogén,plazminogén s delečným mutantom, v ktorom je stredná časť molekuly odstránená,...

Rekombinantné protilátky na liečenie ľudí

Načítavanie...

Číslo patentu: 285960

Dátum: 07.11.2007

Autori: Raab Ronald, Newman Roland, Hanna Nabil

MPK: A61K 38/00, C07K 16/00, C07K 16/18...

Značky: protilátky, rekombinantné, ľudí, liečenie

Zhrnutie / Anotácia:

Opisuje sa chimérna protilátka, ktorá sa viaže špecificky k ľudskému antigénu, je neimunogénna u človeka a nie je taká istá ako ľudská alebo šimpanzia protilátka a ktorá obsahuje polypeptidy s ľahkým a ťažkým reťazcom, z ktorých každý obsahuje: variabilnú oblasť, ktorá má aminokyselinovú sekvenciu variabilnej oblasti protilátky opice Starého sveta vybranej z makakov rézus, makakov jávskych a paviánov, konštantnú oblasť, ktorá má aminokyselinovú...

Rekombinantné novirhabdovírusy a ich použitie

Načítavanie...

Číslo patentu: E 17224

Dátum: 15.06.2007

Autori: Koumans Joseph, Bremont Michel, Harmache Abdallah

MPK: C12N 15/85

Značky: novirhabdovírusy, použitie, rekombinantné

Text:

...oblasti medzi M a G génmi IHNV. Konkretnejšie, pretože tento gén sa vložil v prirodne sa vyskytujúcom Eagľ reštrikčnom mieste umiestnenom medzi koncom M ORF a transkričným terminálnym signálom M génu, tento konštruktobsahoval sekvenciu (CCAAGACAGAAAAAAATGGCAC SEQ ID NO l)(CCAAGACAGAAAAAAA SEQ ID NO 2), nasledoval ne-transkribovaný intergénový dinukleotid TG a transkripčná iniciačná sekvencia GCAC, po uvedenej sekvencii bezprostredne...

Rekombinantné N-glykozylované proteíny z prokaryotických buniek

Načítavanie...

Číslo patentu: E 18568

Dátum: 10.05.2006

Autori: Ahuja Umesh, Kowarik Michael, Aebi Markus

MPK: C07K 14/205, C12P 21/00, C07K 14/25...

Značky: prokaryotických, n-glykozylované, proteiny, rekombinantné, buniek

Text:

...modelového proteínu AcrA0010 Cieľom predloženého vynálezu je poskytnúť proteíny, a tiež prostriedky a spôsoby výroby týchto proteínov, ktoré majú optimalizovanú účinnosť pri N-glykozylácii a možno ich vyrobiť v prokaryotických organizmoch in vivo. Ďalším cieľom predloženého vynálezu je nájsť účinnejšie zavedenie Nglykánov do rekombinantných proteínov pre modiñkáciu antigenicity, stability,biologickej, profylaktickej a/alebo terapeutickej...

Spôsob zlepšenej izolácie rekombinantne tvorených proteínov

Načítavanie...

Číslo patentu: E 9374

Dátum: 29.03.2006

Autor: Winge Stefan

MPK: C07K 14/755, C12P 21/02

Značky: rekombinantné, zlepšenej, proteínov, izolácie, tvořených, spôsob

Text:

...tohto pôsobenia na rýchlosťexpresie rôznych proteínov. A nakoniec, P. M. Dey et al., Planta 202 179-187, opisujú izoláciu glykoproteínov bohatých na hydroxyprolín zo suspenznej kultúry buniek zemiakov premytím zemiakových buniek roztokom obsahujúcim 50 mM CaClg a 2 mM kyselinu askorbovú.0007 Čo sa týka vyššie uvedeného, je zrejmé, že je stále žiadúci všeobecný spôsob na zvýšenie výťažku rekombinantných proteínov z eukaryotických alebo...

Chimérické rekombinantné antigény Toxoplazma gondii

Načítavanie...

Číslo patentu: E 7514

Dátum: 27.02.2006

Autori: Spadoni Andrea, Beghetto Elisa, Gargano Nicola

MPK: C07K 19/00

Značky: rekombinantné, chimerické, toxoplazma, gondii, antigény

Text:

...Kanso), potom neskôr ako izolácia čistých antigénov (EP 0 082 745, Mérieux EP 0 301 961, INSERM,Pasteur W 0 89/5658, Transgene) a charakterizácia ako proteínov, tak ich príslušných génov (W 0 89/08700, U. Leland, Dartmouth Coll. US 4 877 726, Res. Inst. Palo Alto W 0 89/12683, INSERM, Pasteur EP 0 391 319, Mochida Pharm. IT 1 196 817, CNR EP 0 431 541, Behringwerke W 0 92/01067, CNRS W 0 92/02624, U. Flinders W 0 92/11366, Innogenetics,...

Rekombinantne modifikovaný plazmín

Načítavanie...

Číslo patentu: E 18535

Dátum: 21.04.2005

Autori: Hunt Jennifer Audrey, Novokhatny Valery

MPK: C12N 15/57, C12N 5/10, C12N 9/68...

Značky: rekombinantné, modifikovaný, plazmín

Text:

...z 90 , 95 alebo 98 identický so sekvencíou ukázanou vsekv. id. č. 2. Okrem toho kódovaný polypeptid môže byť sekvencia ukázaná v sekv. id. č. 2.0009 Nukleotídová sekvencia polynukleotidu môže byť sekvencia ukázaná v sekv. id. č. l alebo jej degenerované varianty. Nukleotídová sekvencia môže kódovať polypeptid majúci Nkoncovú kringle doménu homológnu s kringle doménou 1 natívneho humánneho plazminogénu a miesto aktivácie C-koncovej domény...

Rekombinantne modifikovaný plazmín

Načítavanie...

Číslo patentu: E 8081

Dátum: 21.04.2005

Autori: Hunt Jennifer Audrey, Novokhatny Valery

MPK: C12N 9/68

Značky: modifikovaný, plazmín, rekombinantné

Text:

...môžu mať polypeptidy vyššiu väzobnú afinitu pre čiastočne rozštiepený fibrín,ako je väzobná aktivita pre čiastočne nerozštiepený fibrín mini-plazmín.0015 V niektorých uskutočneniach polypeptidy môžu mať takú sekvenciu aminokyselín, ako znázorňuje SEQ ID NO 2 a jej konzervatívne substitúcie. Polypeptidy môžu mať zvyšok v relatívnej polohe analógnej k polohe 76 aminokyselinovej sekvencii zaznamenanej V SEQ ID NO 2, čo je arginín.0016 V...

Rekombinantné vakcíny a ich použitie

Načítavanie...

Číslo patentu: E 13583

Dátum: 13.10.2004

Autori: Türeci Özlem, Sahin Ugur, Kreiter Sebastian

MPK: C07K 14/47, A61K 31/7088, A61K 38/17...

Značky: rekombinantné, vakcíny, použitie

Text:

...Cieľom očkovania rekombinantnou vakcínou je indukovať protidefinovanému antigénu špecifickú imunitnú reakciu, ktorá jepreventívne alebo terapeuticky účinná proti definovaným0007 Dôležitým faktorom pre účinnosť rekombinantnej vakcíny je optimálna stimulácia T-lymfocytov imunizovaného organizmu. Napríklad rad výskumov založených na experimentoch na zvieratách potvrdzuje, že na účinnú imunoterapiu nádorov je nutná optimálna stimulácia CD 8 a...

Rekombinantné vírusové vakcíny proti malárii

Načítavanie...

Číslo patentu: E 11288

Dátum: 16.12.2003

Autori: Pau Maria Grazia, Holterman Lennart, Kaspers Jorn, Stegmann Antonius Johannes Hendrikus

MPK: C07K 14/445, C12N 15/30, A61K 39/015...

Značky: proti, vakcíny, vírusové, rekombinantné, malárii

Text:

...dostupná vakcína proti malárii, napriek tomu, že vývoj vakcín proti malárii bol zahájený užpred viac ako 30 rokmi imunizácia potkanov, primátov iného ako ľudského pôvodua ľudských jedincov sporozoitmi oslabenými ožiarenim poskytuje ochranu pred následnou nákazou sporozoitmi (Nussenzweig et al. 1967 Clyde et al. 1973). Avšak nedostatok vhodného veľkokapacitného kultivačného systému na produkciu sporozoitov zabraňuje širšíemu rozšíreniu...

Rekombinantné protilátky proti interleukínu-5

Načítavanie...

Číslo patentu: 282625

Dátum: 23.09.2002

Autori: Bodmer Mark William, Emtage John Spencer, Athwal Diljeet Singh

MPK: A61K 39/395, C12N 15/13, C07K 16/24...

Značky: protilátky, rekombinantné, interleukínu-5, proti

Zhrnutie / Anotácia:

Je opísaná rekombinantná protilátková molekula, ktorá má afinitu pre ľudský IL-5 antigén, DNA sekvencia kódujúca ťažký a/alebo ľahký reťazec protilátky, farmaceutická kompozícia obsahujúca protilátku a použitie protilátky na výrobu liečiva.

Sekvencie DNA, rekombinantné molekuly DNA a spôsob výroby polypeptidov podobných rastovému hormónu ošípanej

Načítavanie...

Číslo patentu: 278336

Dátum: 04.12.1996

Autori: Schulz Marie-francoise, Movva Nageswararao

MPK: C12N 15/18, C12N 15/70, C12N 15/64...

Značky: ošípanej, spôsob, výroby, podobných, molekuly, rastovému, polypeptidov, rekombinantné, hormonu, sekvencie

Zhrnutie / Anotácia:

Opisujú sa sekvencie DNA, rekombinantné molekuly DNA a spôsoby výroby rastového hormónu ošípanej (SGH) a polypeptidov s účinnosťou rastového hormónu ošípanej. Tieto peptidy sa môžu využiť pri výrobe polypeptidov určených pre ošípané ako všeobecné anaboliká, na zintenzívnenie rastu a zvýšenie produkcie mäsa týchto zvierat.

Biologický spôsob výroby kyseliny 7-aminodeacetylcefalosporánovej a kyseliny 7-aminocefalosporánovej, rekombinantné DNA expresné vektory a rekombinantné produkčné kmene Penicillium chrysogenum na vykonávanie tohto spôsobu a použitie rekombinantnýc…

Načítavanie...

Číslo patentu: 280569

Dátum: 06.11.1996

Autori: Stepan Anthony Michael, Mcada Phyllis, Rambosek John, Conder Michael, Reeves Christopher, Crawford Lorilee

MPK: C12P 35/02, C12N 1/15, C12N 15/52...

Značky: 7-amínocefalosporánovej, tohto, chrysogenum, penicillium, kyseliny, vektory, expresné, spôsob, kmene, výroby, rekombinantnýc, biologicky, 7-aminodeacetylcefalosporánovej, vykonávanie, rekombinantné, spôsobu, produkčné, použitie

Zhrnutie / Anotácia:

Medziprodukty sú dôležité na prípravu cefalosporínových antibiotík, kyseliny 7-aminodeacetylcefalosporánovej, 7-ADAC a kyseliny 7-aminocefalosporánovej 7-ACA. Tieto kyseliny sa pripravujú novým biologickým spôsobom, pri ktorom sa pestuje transformovaný kmeň Penicillium chrysogenum v prítomnosti adipátu za vzniku adipoyl-6-APA s následnou expresiou génov, použitých na transformáciu a to 1. génu pre expandázu za vzniku adipoyl-7-ADAC, 2. génu pre...

Imunogénne polypeptidy schopné vyvolať imunitnú odpoveď proti parazitom rodu Eimeria, DNA kódujúca tieto polypeptidy, rekombinantné vektory a transformované mikroorganizmy, spôsoby ich prípravy a vakcína proti kokcidióze

Načítavanie...

Číslo patentu: 281606

Dátum: 07.09.1994

Autori: Pasamontes Luis, Binger Mary-helen

MPK: C07K 5/08, C07K 14/455, A61K 39/002...

Značky: eimeria, transformované, vektory, proti, spôsoby, schopné, vakcína, parazitom, rekombinantné, imunogénne, mikroorganizmy, tieto, vyvolať, kódujúca, kokcidióze, polypeptidy, odpoveď, imunitnú, přípravy

Zhrnutie / Anotácia:

Polypeptid so sekvenciou aminokyselín a jeho fragmenty, ktoré sú schopné vyvolať imunitnú odpoveď proti parazitom rodu Eimeria, DNA kódujúca tieto polypeptidy a rekombinantné vektory. Ďalej je opísaný spôsob prípravy polypeptidu, rekombinantného vektora, rekombinantného vírusu a transformovaného mikroorganizmu. Imunogénny polypeptid je použiteľný na imunizáciu subjektu proti kokcidióze. Vakcína obsahujúca opísaný polypeptid, rekombinantný vírus...