Patenty so značkou «použitie»

Strana 52

Chinazolínové deriváty a ich použitie pri liečbe trombocytémie

Načítavanie...

Číslo patentu: E 7380

Dátum: 04.08.2005

Autor: Franklin Richard

MPK: A61K 31/519, C07D 239/00, A61K 31/505...

Značky: liečbe, trombocytémie, použitie, chinazolínové, deriváty

Text:

...(1981) Disposition of anagrelide, an inhibitor of platelet aggregation. Clin Pharmacol Ther. 29 381-6.Ciele predloženého vynálezu zahŕňajú cieľ poskytnúť zlúčeniny príbuznéanagrelidu, ktoré možno použit na liečbu trombocytémie.Vjednom uskutočnení predložený vynález poskytuje zlúčeninu, ktorou jejej rovnovážnu formu, jej farmaceuticky prijateľnú soľ alebo farmaceuticky prijateľnú soľ jej rovnovážnej formy, kde R 1 je H, C 15 alkyl, C 26...

Kvapalné kompozície obsahujúce arginín a kyselinu alfa-lipoovú a ich použitie na zlepšenie sexuálnej funkcie

Načítavanie...

Číslo patentu: E 5362

Dátum: 04.08.2005

Autor: Wessel Klaus

MPK: A61K 31/385, A61P 15/00, A61K 31/185...

Značky: funkcie, kvapalné, alfa-lipoovú, sexuálnej, kompozície, použitie, obsahujúce, arginín, kyselinu, zlepšenie

Text:

...predčasnej ejakulácie a tiež nepomáhajú ženám. Dokonca nepomáha v prípadoch psychogénnej ED.Kyselina alfa-lipoová je známa na medicínske, nutričné afannaceutické použitie už desiatky rokov Jej použitie bolo navrhnuté bud ako racemická zmes, alebo ako jeden enantiomér alebo zmes enantiomérov (DE 4035442 A 1). Tiež bolo navrhnuté modifikovať ju chemicky (napríklad s redukovaným ditíolom, liponamídom a jej derivátmi ako je opísané vUS 6387 945 B...

Použitie alfa-1 antitrypsínu na prípravu liečiv na liečbu fibromyalgie

Načítavanie...

Číslo patentu: E 1637

Dátum: 04.08.2005

Autor: Blanco Blanco Ignacio

MPK: A61P 19/00, A61K 38/55

Značky: fibromyalgie, použitie, antitrypsínu, liečbu, liečiv, alfa-1, přípravu

Text:

...tak bez toho, aby vynálezca chcel byť viazaný nejakou hypotézou a bezakéhokoľvek obmedzenia, navrhol hypotézu, že AAT má dôležitú úlohu v ovládaní zápalovejzložky spojivového tkaniva skeletového prvku zodpovedného za indukciu bolesti a telesné0013 Na overenie uvedených účinkov nových liečiv zistených experimentálne autor vynálezu uskutočnil skúšky na ľuďoch, ktorých podrobnosti sú opísané nižšie V nasledujúcich Príkladoch.0014 Pacientka...

Hygienická pomôcka na jednorazové použitie s kombinovaným mechanickým a lepiacim uzatváracím systémom

Načítavanie...

Číslo patentu: 284687

Dátum: 03.08.2005

Autor: Malowaniec Krzysztof

MPK: A61F 13/58

Značky: kombinovaným, pomôcka, systémom, použitie, hygienická, lepiacim, uzatváracím, jednorázové, mechanickým

Zhrnutie / Anotácia:

Hygienická pomôcka obsahuje predný diel (12), zadný diel (14) a medzi nimi ležiacu oblasť (16) rozkroku s uzavieracími sponami (24, 26) umiestnenými na bočných okrajoch (20, 22) zadného dielu (14) na spájanie zadného dielu (14) s predným dielom (12) na uzatvorenie pomôcky (10) priloženej na nositeľa, pričom uzavieracie spony (24, 26) sú vybavené prvými mechanickými uzavieracími prvkami (32), ktoré pri uzatváraní pomôcky spolupôsobia s druhými,...

N-(1H-indolyl)-1H-indol-2-karboxamidové deriváty, ich príprava a ich použitie v terapii

Načítavanie...

Číslo patentu: E 5097

Dátum: 02.08.2005

Autori: Dubois Laurent, Even Luc, Evanno Yannick

MPK: A61K 31/403, C07D 209/00, A61P 29/00...

Značky: terapii, deriváty, príprava, použitie, n-(1h-indolyl)-1h-indol-2-karboxamidové

Text:

...nasýtená alifatická skupina. Ako príklady sa dajú uviesť skupiny metyl, etyl, propyl, izopropyl, butyl, izobutyl, terc-butyl, pentyl, atď.cykloalkylom cyklická uhlíková skupina. Ako príklady sa dajú uviesť skupiny cyklopropyl, cyklobutyl, cyklopentyl, cyklohexyl, atdĺñuóralkylom alkylová skupina, v ktorej sa jeden alebo niekoľko atómov vodíka substítuovaloatómom fluóru skupinou alkoxy -O-alkylová skupina, v ktorej je alkylovým zvyškom...

Použitie K-252a a inhibítora kinázy na prevenciu alebo liečenie patológií spojených s HMGB1

Načítavanie...

Číslo patentu: E 6270

Dátum: 29.07.2005

Autori: Mainero Valentina, Fumero Silvano, Traversa Silvio, Barone Domenico, Pilato Francesco, Bertarione Rava Rossa Luisa

MPK: A61P 13/00, A61K 31/553, A61P 1/00...

Značky: kinázy, prevenciu, patológií, hmgb1, inhibítora, použitie, spojených, liečenie, k-252a

Text:

...faktoru, najmä na liečenie zápalu, alergií, rakoviny. sepsy, MS,reumatoidnej artritidy alebo psoriázy. W 0 96/13506 sa týka použitia K-252 a derivátu na liečenie neurologických ochorení.Chirurgická procesy počas angioplastiky často vyvolávajú poškodenia intimy spôsobujúce poškodenie a nekrózu rôznych typov buniek, vrátane endotelových buniek. Toto môže vyústit do restenózy, stavu charakterizovaného znovu uzavretím artérií - spôsobeným spätnou...

Spôsob výroby baccatínu, enzým, spôsob prípravy enzýmu a jeho použitie

Načítavanie...

Číslo patentu: 284676

Dátum: 29.07.2005

Autori: Bombardelli Ezio, Menhard Birgitta, Zenk Meinhart Hans

MPK: C12P 17/02, C07D 305/14, C12N 9/10...

Značky: přípravy, enzymů, výroby, enzym, spôsob, použitie, baccatínu

Zhrnutie / Anotácia:

Je opísaný spôsob prípravy baccatínu a/alebo baccatínových derivátov, pri ktorom reaguje 10-deacetylbaccatín alebo 10-deacetylbaccatínový derivát v prítomnosti izolovaného enzýmu a acetylového donora, pričom ako enzým sa používa acetyltransferáza s molekulovou hmotnosťou od 70 do 72 kD, stanovené SDS-PAGE, ktorá sa získa z Taxus chinensis.

Substituované 1,2,3,4,5,6-hexahydro-2,6-metano-3-benzazocín-10-oly, spôsob ich prípravy, farmaceutický prípravok s ich obsahom a ich použitie

Načítavanie...

Číslo patentu: 284670

Dátum: 28.07.2005

Autori: Palluk Rainer, Carter Adrian, Bechtel Wolf Dietrich, Grauert Matthias, Weiser Thomas, Pschorn Uwe

MPK: C07D 221/26, A61K 31/485, A61K 31/435...

Značky: substituované, prípravok, spôsob, obsahom, 1,2,3,4,5,6-hexahydro-2,6-metano-3-benzazocín-10-oly, přípravy, farmaceutický, použitie

Zhrnutie / Anotácia:

Substituované 1,2,3,4,5,6-hexahydro-2,6-metano-3-benzazocín-10-oly všeobecného vzorca (I), kde X znamená jednoduchú väzbu, -O-, C1-4alkylén, C1-8alkylénový mostík, ktorý môže byť prípadne prerušený atómami kyslíka R1 znamená vodík, metyl, etyl, fenyl R2 znamená vodík alebo metyl R3 znamená vodík, fluór, chlór a iné R4, R5 a R6 znamenajú od seba nezávisle vodík, metyl alebo etyl R7 znamená napríklad terc-butyl, cyklohexyl, fenyl a iné R8 znamená...

Použitie (R)-(halogénbenzyloxy)benzylaminopropánamidov ako selektívnych modulátorov sodíkových a vápnikových kanálov

Načítavanie...

Číslo patentu: E 7835

Dátum: 28.07.2005

Autori: Barbanti Elena, Thaler Florian, Salvati Patricia, Fariello Ruggero, Caccia Carla

MPK: A61K 31/00, A61K 45/00, A61P 1/00...

Značky: kanálov, modulátorov, selektívnych, vápnikových, sodíkových, r)-(halogénbenzyloxy)benzylaminopropánamidov, použitie

Text:

...prevencii neurodegenerácie apri potláčaní neuropatickej bolesti. Rôzne antiepileptické liečivá, ktoré stabilizujú dráždivostneurónov, sú účinné pri neuropatickej bolestitgabapentín, pregabalin).Okrem toho sa v niekoľkých modeloch zápalovej bolesti pozorovalo zvýšenie expresie alebo aktivity sodíkových kanálov, čo naznačuje úlohu sodíkovýchkanálov pri zápalovej bolesti.Vápnikové kanály sú proteíny preklenujúce membránu apozostávajúce...

Diarylmetylpiperazínové deriváty, ich príprava a ich použitie

Načítavanie...

Číslo patentu: E 11605

Dátum: 27.07.2005

Autori: Maciag Carla, Smagin Gennady, Walpole Christopher, Brown William, Hudzik Thomas, Griffin Andrew

MPK: A61P 25/04, A61K 31/495, A61P 25/16...

Značky: príprava, diarylmetylpiperazínové, deriváty, použitie

Text:

...ako enantioméme alebo diastereoméme formy, alebo ako racemické zmesi, a môžu byt takto ízolované. Vynález zahŕňa všetky možné enantioméry, diastereoméry a racemáty zlúčeniny vzorca I a ich zmesi. Opticky aktívne formy zlúčeniny podľa vynálezu je možné pripraviť napríklad pomocou rozdelenia racemátu s použitím chirálnej chromatografie, pomocou syntézy z opticky aktívnych počiatočných materiálov alebo pomocou asymetrickej syntézy, na základe...

N-Hydroxyamidové deriváty a ich použitie

Načítavanie...

Číslo patentu: E 5865

Dátum: 25.07.2005

Autori: Jorand-lebrun Catherine, Crosignani Stefano, Gerber Patrick, Bombrun Agnes, Swinnen Dominique, Gonzalez Jerome

MPK: C07D 211/00, A61P 29/00, A61K 31/496...

Značky: deriváty, n-hydroxyamidové, použitie

Text:

...známa ako stromelyzin 1), má ako substráty kotagén III, kotagén IV, kotagén V, kotagén IX, kotagén X, Iaminin, nidogén, Predpokladá sa, že nadmerná expresia je zahmutá v ateroskleróze, aneuryzma a restenóze.Želatínázy - predpokladá sa, že inhibícia spôsobuje priaznivý účinok na rakovinu, zvlášť na inváziu a metastázy.MMP-2 (tiež známa ako želatináza A, 72 kDa želatináza, bazálna membránová kolagenáza, alebo proteoglykanáza), má ako...

Farmaceutický prostriedok obsahujúci indolové zlúčeniny a estrogény a jeho použitie

Načítavanie...

Číslo patentu: 284666

Dátum: 25.07.2005

Autori: Komm Barry Samuel, Pickar James Harrison

MPK: A61K 31/404, A61K 31/565, A61P 5/00...

Značky: prostriedok, farmaceutický, použitie, zlúčeniny, estrogény, obsahujúci, indolové

Zhrnutie / Anotácia:

Farmaceutický prostriedok obsahujúci jeden alebo viac estrogénov a zlúčeninu všeobecného vzorca (I) alebo (II). Použitie estrogénu a zlúčeniny všeobecného vzorca (I) alebo (II) na prípravu liečiva na liečenie alebo prevenciu kardiovaskulárnej choroby, chorôb u cicavcov, ktoré majú za následok proliferáciu alebo abnormálny vývoj, reakcie alebo rast endometriálneho tkaniva alebo tkaniva jemu podobného alebo chorobných stavov alebo syndrómov,...

Tabletová formulácia s predĺženým uvoľňovaním obsahujúca pramipexol alebo jeho farmaceuticky prijateľnú soľ, spôsob jej výroby a jej použitie

Načítavanie...

Číslo patentu: E 8697

Dátum: 25.07.2005

Autori: Friedl Thomas, Eisenreich Wolfram

MPK: A61K 31/4745, A61K 9/00, A61K 31/428...

Značky: obsahujúca, použitie, uvoľňovaním, tabletová, výroby, prijateľnú, formulácia, predĺženým, farmaceutický, pramipexol, spôsob, soľ

Text:

...eróziou gélovej vrstvy, rozpúšťaním polyrnéru alebo kombináciou uvedených mechanizmov uvoľňovania.Preukázalo sa však ako obťažné forrnulovat tabletu, ktorá by vykazovala vhodnú kombináciu modifikovaných vlastností, vlastností s predĺženým alebo trvalým uvoľňovaním a manipulačných vlastností, kde liečivo je takým liečivom, ktoré vykazuje relatívne vysokúrozpustnosť, ako je to v prípade dihydrochloridu pramipexolu.Jestvuje celý rad metód...

2-(pyridín-2-yl)-pyrimidíny a ich použitie na ničenie choroboplodných húb

Načítavanie...

Číslo patentu: E 7024

Dátum: 22.07.2005

Autori: Rheinheimer Joachim, Stierl Reinhard, Schieweck Frank, Grote Thomas, Müller Bernd, Schäfer Peter, Gewehr Markus, Strathmann Siegfried, Schwögler Anja, Köhle Harald, Grammenos Wassilios, Schöfl Ulrich, Rether Jan, Scherer Maria, Hünger Udo, Blettner Carsten

MPK: C07D 401/00, A01N 43/48

Značky: ničenie, 2-(pyridín-2-yl)-pyrimidíny, choroboplodných, použitie

Text:

...húb) ako aj spôsob ničenia fytopatogénnych choroboplodných húb, vyznačujúci sa tým, že sa huby alebo materiály, rastliny, pôdy alebo osivo, ktoré majú byť chránené pred napadnutím hubami, ošetria účinným množstvom zlúčeniny všeobecného vzorca l a/aleboúčinným množstvom soli zlúčeniny I, ktorá je prijateľné na poľnohospodárske účely.Predmetom predloženého vynálezu je ďalej prostriedok na ničenie choroboplodných húb obsahujúci prinajmenšom...

Biologicky účinná frakcia rastlinného melanínu, spôsob jej výroby, farmaceutický prostriedok s jej obsahom a jej použitie

Načítavanie...

Číslo patentu: 284664

Dátum: 22.07.2005

Autor: Keresteš Ján

MPK: A61K 35/78, C09B 67/54, C09B 61/00...

Značky: použitie, obsahom, melanínu, výroby, rastlinného, frakcia, účinná, prostriedok, biologicky, spôsob, farmaceutický

Zhrnutie / Anotácia:

Biologicky aktívna frakcia rastlinného melanínu získateľná spôsobom, pri ktorom sa na rastlinnú surovinu obsahujúcu natívny polymér a/alebo základné stavebné jednotky, ako napríklad katechíny a leukoantokyanidíny, pôsobí 0,05 až 0,3M vodným roztokom hydroxidu alkalického kovu pri teplote 15 až 75 °C, pH extraktu sa nastaví na 1 až 2 pridaním anorganickej kyseliny na báze chlóru, pričom vylúčený sediment sa vyčistí a následne vysuší pri 100 až...

Vylepšené fotosenzibilizátorové formulácie a ich použitie

Načítavanie...

Číslo patentu: E 20090

Dátum: 22.07.2005

Autori: Nikolay Nifantiev, Albrecht Volker

MPK: A61K 31/195, A61K 31/366, A61K 31/409...

Značky: použitie, vylepšené, fotosenzibilizátorové, formulácie

Text:

...4 mg/ml formou intravenóznej injekcie.Niektoré, ďalšie bežne používané porfyríny pri fotodynamickej terapii sú Hematoporfyrín IX (HpIX), derivát Hematoporfyrínu (HpD) a rôzne HpD prípravky, ako napríklad Photofrin® (porfimer sodný, Axcan Pharma PDT Inc.). Pre liečenie zhubného nádorového ochorenia pažeráku a nemalobunkového endobronchiálneho zhubného nádorového ochorenia má Photofrin® doporučené dávkovanie 2 mg/kg telesnej hmotnosti, ktorý...

Heterocyklické deriváty inhibujúce faktor Xa, farmaceutický prostriedok s ich obsahom, spôsob ich prípravy a ich použitie

Načítavanie...

Číslo patentu: 284665

Dátum: 21.07.2005

Autori: Turner Paul, Rayner John Wall, Preston John, Smithers Michael James, Stocker Andrew

MPK: C07D 213/56, A61K 31/44, A61K 31/505...

Značky: deriváty, inhibujúce, spôsob, faktor, přípravy, farmaceutický, použitie, heterocyklické, obsahom, prostriedok

Zhrnutie / Anotácia:

Opísané sú heterocyklické deriváty všeobecného vzorca (I) alebo ich farmaceuticky prijateľné soli, ktoré majú antitrombotické a antikoagulačné vlastnosti, inbibujúce faktor Xa, vhodné pri liečbe človeka alebo živočíchov. Tiež sa opisuje spôsob prípravy týchto heterocyklických derivátov, farmaceutické prostriedky, ktoré ich obsahujú, a ich použitie na prípravu liečiv, ktoré majú antitrombotické alebo antikoagulačné účinky.

Oxopiperidínové deriváty, ich príprava a ich použitie v terapii

Načítavanie...

Číslo patentu: E 7350

Dátum: 20.07.2005

Autori: Courtemanche Gilles, Braun Alain, Fett Eykmar, Pascal Cécile, Crespin Olivier

MPK: A61P 15/00, A61K 31/445, C07D 295/00...

Značky: príprava, terapii, oxopiperidínové, deriváty, použitie

Text:

...typu substituované fenylovým jadrom. Pokiaľ ide o prihlášku W 0 03/094918, táto prihláška opisuje deriváty piperazínového typu substituované fenylovým alebo pyridinylovým jadrom. Taktiež možno uviest prihlášky W 0 00/74679, W 0 01/70708, W 0 02/ 15909, W 0 02/079146, W 0 03/007949 a W 0 04/024720, ktoré opisujú substituované deriváty piperidínového typu, alebo ešte prihlášku W 0 04/037797 zlúčeniny opisané v týchto patentových...

1,4-Dihydropyridín-kondenzované heterocykly, spôsob ich prípravy, ich použitie a kompozície, ktoré ich obsahujú

Načítavanie...

Číslo patentu: E 7152

Dátum: 20.07.2005

Autori: Nair Anil, Angouillant-boniface Odile, Ma Nina, Mignani Serge, Bjergarde Kirsten, Filoche-romme Bruno, Mauger Jacques

MPK: C07D 471/00, A61K 31/4162

Značky: použitie, spôsob, přípravy, 1,4-dihydropyridín-kondenzované, heterocykly, kompozície, obsahujú

Text:

...ktorá môže viesť k závažným vedľajším účinkom a/alebo k vyššej toxicite voči inaktívnym bunkám. Výsledkom je, že zlúčeniny podľa vynálezu väčšinou zabraňujú inhibícii CDK 7 a/alebo CDK 9 kinázam alebo aspoň inhíbičný pomer jepriaznivý pre Aurora kinázu.0006 Najbližší stav techniky vzhľadom na zlúčeniny vzorcov (I) a (II) podľa predkladanéhovynálezu predstavuje podľa názoru prihlasovateľaDrizin, Irene Holladay, Mark W. Yi, Lin...

Aminotropanové deriváty, ich príprava a ich použitie v terapii

Načítavanie...

Číslo patentu: E 5429

Dátum: 20.07.2005

Autori: Cornet Bruno, Courtemanche Gilles, Pascal Cécile, Braun Alain, Crespin Olivier

MPK: A61K 31/55, A61K 31/46, A61P 15/00...

Značky: deriváty, aminotropanové, príprava, použitie, terapii

Text:

...deriváty typu substituovanćho piperidínu, alebo ešte prihlášku W 0 04/037797 zlúčeniny opisané v týchto patentových prihláškachvždy obsahujú arnidovú funkciu a napodobňujú skôr známe peptidovć štruktúry.0008 Vzhľadom k neustálej potrebe zlepšiť existujúce terapie vyššie uvedených patológií si vynálezci dali za cieľ poskytnúť nové zlúčeniny agonizujúce receptory melanokortínov.Predmetom tohto vynálezu sú zlúčeniny zodpovedajúce vzorcu (I)R, a...

Soľ kyseliny šťaveľovej s 5-[4-[2-(N-metyl-N-(2-pyridyl)amino)etoxy]-benzyl]-tiazolidín-2,4- diónom a spôsob jej prípravy a jej použitie

Načítavanie...

Číslo patentu: E 3000

Dátum: 20.07.2005

Autor: Halama Aleš

MPK: C07D 417/00, A61K 31/4402, A61P 3/00...

Značky: spôsob, kyseliny, šťaveľovej, diónom, přípravy, použitie, 5-[4-[2-(n-metyl-n-(2-pyridyl)amino)etoxy]-benzyl]-tiazolidín-2,4

Text:

...nevzniká soľ vzorca IV, ako by bolo možné predpokladať, ale ekvimolámazmes soli vzorca III a rosiglitazónu I.IV 0008 Pokiaľ sa pri reakcii zlúčeniny vzorca I s kyselinou šťaveľovou použije nadbytok kyseliny šťaveľovej (príklad 4), získa sa ako výlučný produkt kryštalícká soľ zlúčeniny vzorca III, ktorá obsahuje látku vzorca I a kyselinu šťaveľovú v pomere 11. Vyššie opísané efekty majú mimoriadny vplyv na dosiahnuteľnú čistotu a stabilitu0009...

Amóniové soli a klatráty amóniových/minerálnych solí ako transportné a účinné formy farmaceuticko-medicínskych aplikácií a na použitie ako fázové transferové činidlá pre chemické aplikácie

Načítavanie...

Číslo patentu: E 9185

Dátum: 20.07.2005

Autori: Kasch Helmut, Oettmeier Ralf, Reuter Uwe

MPK: C07C 211/63

Značky: účinné, chemické, solí, formy, fázové, transportné, aplikácie, činidla, použitie, amóniové, aplikácii, farmaceuticko-medicínskych, klatráty, transferové

Text:

...sa doteraz využívali nákladné, ekologicky zaťažujúce a málo efektívne spôsoby (reakcia s fosgénom, výroba uretánov, reakcia preskupovania). Enantioselektívne syntézy alebo diastereoselektívne syntézy neboli doteraz uskutočňované. Soli fázového transferu, pomocou ktorých sa z vicinálnych halogénhydrínov vyrábajú cyklické karbonáty,doteraz v dôsledku nedostatočných výťažkov prípadne použitia nevhodných vodných rozpúšťadiel (C. Venturello, R....

Inhibítory proteínu podobného angiopoetínu 4, kombinácie a ich použitie

Načítavanie...

Číslo patentu: E 7068

Dátum: 19.07.2005

Autori: Ferrara Napoleone, Liang Xiao Huan, Gerber Hans-peter

MPK: C07K 16/00

Značky: podobného, inhibitory, angiopoetínu, proteínu, použitie, kombinácie

Text:

...vynálezu ANGPTL 4 antagonista je molekula SiRNA. Vjednom uskutočnení SiRNA molekula je ANGPTL 4-SiRNA molekula, kde molekula je zameraná na sekvenciu DNA (napriklad GTGGCCAAGCCTGCCCGAAGA, SEQ lD N 03) nukleovej kyseliny kódujúcej ANGPTL 4.0015 Poskytujú sa spôsoby blokovania alebo redukovania rastu nádoru alebo rastu rakovinových buniek. Vurčitých uskutočneniach spôsoby zahŕňajú podávanie účinného množstva antagonistu podobného...

Sulfoaluminátový slinok s vysokým obsahom belitu, spôsob jeho výroby a jeho použitie na prípravu hydraulických spojív

Načítavanie...

Číslo patentu: E 5998

Dátum: 19.07.2005

Autori: Li Guanshu, Gartner Ellis

MPK: C04B 7/00, C04B 28/00

Značky: spojív, spôsob, přípravu, slinok, obsahom, výroby, použitie, sulfoaluminátový, belitu, vysokým, hydraulických

Text:

...hydraulických cementov medzi nimi systémy založené na kalciumalluminátoch (altematívne hlinitan vápenatýyalebo kalciumsulfátoch .Cementy svysokým obsahom hliníka ako Cement Fondu od LAFARGE sú známe z dôvodu ich schopností získať zvýšenú odolnost za krátky čas ale niekedy vytvárajú dobreznámy problém konverzie, ktorý je sprevádzaný prepadom mechanickej odolnosti a navyše ich výroba vyžaduje vysoko špecializované zariadenia, veľkú spotrebu...

Deriváty kyseliny antranilovej ako modulátory rezistencie proti mnohým liekom, spôsob ich prípravy, ich použitie a farmaceutický alebo veterinárny prípravok s ich obsahom

Načítavanie...

Číslo patentu: 284649

Dátum: 18.07.2005

Autori: Sanderson Jason Terry, Ryder Hamish, Maximen Levi Michael, Roe Michael Bryan, Brumwell Julie Elizabeth, Williams Susannah, Hunjan Sukhjit, Folkes Adrian John, Ashworth Philip Anthony

MPK: A61K 31/47, C07D 217/04

Značky: modulátory, rezistencie, spôsob, proti, prípravok, kyseliny, použitie, liekom, obsahom, mnohým, veterinárny, antranilovej, deriváty, farmaceutický, přípravy

Zhrnutie / Anotácia:

Sú opísané deriváty kyseliny antranilovej ako modulátory rezistencie proti mnohým liekom všeobecného vzorca (I) a ich farmaceuticky prijateľné soli, kde každé z R až R9 sú organické substituenty, n je 0 alebo 1, m je 0 alebo celé číslo od 1 do 6, q je 0 alebo 1, X je priama väzba, O, S, -CH2-(CH2)p- alebo -O-(CH2)p-, kde p je celé číslo od 1 do 6 a Ar je nenasýtená karbocyklická alebo heterocyklická skupina, ktoré sú aktívne ako inhibítory...

Bicyklická aromatická aminokyselina, spôsob jej prípravy, jej použitie a farmaceutický prostriedok, ktorý ju obsahuje

Načítavanie...

Číslo patentu: 284646

Dátum: 15.07.2005

Autori: Raddatz Peter, März Joachim, Wiesner Matthias, Goodman Simon, Rippmann Friedrich, Diefenbach Beate

MPK: A61K 31/535, A61K 31/335, C07D 265/36...

Značky: spôsob, aminokyselina, aromatická, použitie, ktorý, obsahuje, bicyklická, farmaceutický, přípravy, prostriedok

Zhrnutie / Anotácia:

Opísaná je bicyklická aromatická aminokyselina všeobecného vzorca (I) a jej fyziologicky vhodné soli ako GPIIb/IIa-antagonisty a ako inhibítory alfav-integrínu na výrobu farmaceutických prostriedkov na liečbu napríklad patologických angiogénnych chorôb, trombóz, infarktu srdca, koronárnych ochorení srdca, artériosklerózy, nádorov, osteoporózy, zápalov a infekcií.

Deriváty kyseliny 3-aryl-2-hydroxypropiónovej, farmaceutický prípravok s ich obsahom a ich použitie

Načítavanie...

Číslo patentu: 284642

Dátum: 15.07.2005

Autor: Andersson Kjell

MPK: C07C 309/66, A61K 31/19

Značky: použitie, deriváty, kyseliny, obsahom, prípravok, farmaceutický, 3-aryl-2-hydroxypropiónovej

Zhrnutie / Anotácia:

Sú opísané deriváty kyseliny 3-aryl-2-hydroxypropiónovej vzorca (I) a ich farmaceuticky prijateľné soli, solváty a kryštalické formy, spôsob a medziprodukty na ich prípravu, farmaceutické prípravky, ktoré ich obsahujú, a použitie zlúčeniny pri klinických stavoch spojených s inzulínovou rezistenciou.

Oxazolové deriváty ako činidlá histamínových H3 receptorov, ich príprava a terapeutické použitie

Načítavanie...

Číslo patentu: E 6000

Dátum: 14.07.2005

Autori: Jesudason Cynthia Darshini, Vaught Grant Matthews, Gadski Robert Alan, Boulet Serge Louis, Pickard Richard Todd, Hornback William Joseph, Finn Terry Patrick, Stevens Freddie Craig, Beavers Lisa Selsam

MPK: C07D 263/00, A61K 31/422, A61P 25/00...

Značky: receptorov, činidla, deriváty, oxazolové, histamínových, použitie, terapeutické, príprava

Text:

...zmenila biológiu histamínu a musí byt uvažovaná pri vývoji0005 Boli vytvorené niektoré antagonisty histamínového H 3 receptora, ktoré napodobňujú histamín tým, že. obsahujú imidazolový kruh všeobecne substituovaný v polohe 4(5) (Ganellin a kol., Ars Pharmaceutica, 1995, 363,455-468). Rad patentov a patentových prihlášok, týkajúcich sa antagonistov a agonistov s touto štruktúrou zahŕňajúcich EP 197840, EP 494010, WO 97/29092, WO 96/38141, a...

Baktericídna kompozícia na použitie v poľnohospodárstve alebo v záhradníctve a spôsob regulácie chorôb rastlín

Načítavanie...

Číslo patentu: E 9210

Dátum: 14.07.2005

Autor: Sugimoto

MPK: A01N 43/50, A01P 3/00, A01N 47/12...

Značky: baktericídna, rastlín, regulácie, kompozícia, spôsob, použitie, záhradníctve, chorôb, poľnohospodárstve

Text:

...pravdepodobne môžu byť infikované patogénnymi hubami, a je vhodná na reguláciu chorôb ako je múčnatka (powdery míldew), pleseň (downy míldew), antraknóza,pleseň šedá, zelená pleseň, chrastavitosť (scab), alternáriová škvmitosť listov (alternaria leaf spot), bakteriálna sneť (bacterial blight), listová sneť (leaf blight), lusková a stonková sneť (pod and stem blight), hníloba zrelých plodov (ripe rot), pleseň zemiaková (late blight),...

2-(1H-Indolylsulfanyl) arylamínové deriváty na použitie na liečenie afektívnych porúch, bolesti, ADHD a stresovej močovej inkontinencie

Načítavanie...

Číslo patentu: E 5314

Dátum: 13.07.2005

Autori: Juhl Karsten, Kehler Jan, Kroll Friedrich

MPK: A61P 25/00, C07D 209/00, A61K 31/496...

Značky: arylamínové, deriváty, afektívnych, liečenie, močovej, 2-(1h-indolylsulfanyl, bolesti, poruch, inkontinencie, použitie, stresovej

Text:

...sexuálnu dysfunkčnosť ako liečba samotnými SSRIs(Kennedy S. H. adalší Combining Bupropion SR With Venlafaxine, Paroxetine, or Duloxetine A Prelimínary Report on Farmacokinetic, Therapeutic, and Sexual Dysfunction Effects J. Clin. Psychiatry 2002, 63, 181-186).0015 Opísane boli difenylsulfidy vzorca I| a ich obmeny ako inhibítory spätného vychytávania serotonínu a sú navrhované na použitie na liečenie depresie porovnaj napríklad s W 0 03 029...

Použitie komplexných lipidov ako stabilizujúcich prísad do farmaceutických prípravkov zmesí zažívacích enzýmov

Načítavanie...

Číslo patentu: 284639

Dátum: 13.07.2005

Autor: Galle Manfred

MPK: A61K 38/46, A61K 47/24

Značky: přísad, lipidov, zažívacích, použitie, zmesí, prípravkov, stabilizujúcich, enzýmov, komplexných, farmaceutických

Zhrnutie / Anotácia:

Použitie komplexných lipidov, najmä lecitínu, proti vplyvom vlhkosti spôsobenému poklesu lipolytickej aktivity vo vodných farmaceutických prípravkoch z lipázy a proteázy obsahujúcich zmesí zažívacích enzýmov, ktoré sú vhodné na prípravu vodných roztokov na kontinuálne zavádzanie do gastrointestinálneho traktu pomocou sond.

Použitie luminiscenčných pigmentov typu ruténium (II) v bezpečnostných dokumentoch, a spôsob a zariadenia k ich detekcii

Načítavanie...

Číslo patentu: E 6508

Dátum: 12.07.2005

Autori: Grande Vicente Cristina, Diez Lopez Raul, Delgado Alonso Jesus, Garcia Alonso Jose Luis, Sanchez Gonzalez Marcelino, Orellana Moraleda Guillermo, Gamo Aranda Francisco Javier, Garcia Fresnadillo David

MPK: C09K 11/06, B42D 15/00, C07F 15/00...

Značky: použitie, zariadenia, bezpečnostných, luminiscenčných, dokumentoch, pigmentov, detekcii, spôsob, ruténium

Text:

...na životnosti emitovaného žiarenia. Životnosť fotoluminiscencie (alebo jednoducho luminiscencia) môže byt definovaná. ako inverzia rýchlostnej konštanty kinetiky prvého rádu procesu, vdaka ktorému prebieha spontánna deaktivácia luminiscenčného elektronického stavu po jeho vytvorení. Pokiaľ prebieha deaktivácia kinetickým procesom, ktorý je komplexnejši než prvého rádu, je bežné odhadnúť priemernú životnost fotoluminiscencie (ako je opisané...

Polymérna adhézna matrica s vysolenými karboxylovými skupinami na transdermálne použitie

Načítavanie...

Číslo patentu: E 11691

Dátum: 06.07.2005

Autori: Romelli Pierbruno, Scarsetto Alberto, Di Grigoli Maurizio, Stefanelli Paola

MPK: A61K 31/192, A61K 47/32, A61K 47/18...

Značky: polymérna, vysolenými, skupinami, matrica, adhézna, transdermálne, použitie, karboxylovými

Text:

...etyléndiamln, Iyzln.0019 Matrice podľa predkladaného vynálezu dalej zahmujú od 0.1 do 20 hmotnostných vody,výhodne 1 až 5 .0020 Vynález umožňuje formovať akúkoľvek účinnú zložku. majúcu terapeutický, dermatologický alebo kozmetický účinok pri podávaní prostrednictvom topikálnej alalebo transderrnálnej cesty. 0021 Príklady medikamentov, ktoré sa môžu výhodne formovať podľa vynálezu, zahmujú nesteroidné protizápalové látky,...

Preparácia a použitie bivalentnej vakcíny proti závislosti na morfínu a heroínu

Načítavanie...

Číslo patentu: E 15308

Dátum: 05.07.2005

Autori: Leff Gelman Philippe, Antón Palma Benito

MPK: A61K 47/48, A61P 25/36

Značky: závislosti, proti, použitie, heroínu, vakcíny, morfínu, preparácia, bivalentnej

Text:

...najrozšírenejšiu skupinu drog vyvolávajúcich celosvetovo najvyššiu úroveň morbidity V dôsledku závislosti. V rozvojových krajinách ako je Mexiko udávajú epidemiologické dáta z posledného Národného výskumu závislostí (M. E. Medina-Mora a E. Rojas Guiot, Salud Mental,26(2) 1-11, 2003) alarmujúci nárast konzumácie týchto substancií v centrálnej časti krajiny, ako aj v mestách ležiacich medzi Mexikom a hranicou s USA. Na klinickej úrovni existuje...

Benzamidoxímové deriváty, medziprodukty na ich prípravu, fungicídne kompozície s ich obsahom a ich použitie ako fungicídov

Načítavanie...

Číslo patentu: 284626

Dátum: 04.07.2005

Autori: Ammermann Eberhard, Strathmann Siegfried, Lorenz Gisela, Eicken Karl, Rheinheimer Joachim, Wetterich Frank

MPK: A01N 43/10, A01N 43/56, A01N 37/52...

Značky: deriváty, medziprodukty, benzamidoxímové, fungicídov, použitie, kompozície, přípravu, fungicidně, obsahom

Zhrnutie / Anotácia:

Opisujú sa benzadoxímové deriváty vzorca (I), v ktorom substituenty majú nasledujúce významy: R1 predstavuje vodík alebo fluór R2 znamená C1-C4-alkyl, ktorý môže byť substituovaný kyanoskupinou, C1-C4-halogénalkyl, C1-C4-alkoxy-C1-C4-alkyl, C3-C6-alkenyl, C3-C6-halogénalkenyl, C3-C6-alkinyl, C3-C8-cykloalkyl-C1-C4-alkyl R3 predstavuje fenyl-C1-C6-alkyl, ktorý môže na fenylovom kruhu niesť jeden alebo viac substituentov zvolených zo skupiny...

Použitie farmaceutickej kombinácie na liečenie závislosti od alkoholu

Načítavanie...

Číslo patentu: 284623

Dátum: 04.07.2005

Autori: Durbin Philippe, Daoust Martine, Bonhomme Yves

MPK: A61K 31/485, A61P 25/32

Značky: liečenie, použitie, závislosti, alkoholů, farmaceutickej, kombinácie

Zhrnutie / Anotácia:

Použitie synergickej kombinácie (i) opioidného antagonistu a (ii) modulátora komplexu receptora NMDA na prípravu farmaceutickej kompozície na liečenie závislosti od alkoholu. Ako opioidný antagonista je výhodne obsiahnutý naltrexon a ako modulátor súboru NMDA receptorov je výhodne obsiahnutý modulátor väzbového miesta spermidínu akamprosát.

Farmaceutická kompozícia s obsahom antioxidantu a použitie antioxidantu na stabilizáciu tejto kompozície

Načítavanie...

Číslo patentu: 284622

Dátum: 04.07.2005

Autori: Horstmann Michael, Asmussen Bodo, Köpke Kai, Tiemessen Harry

MPK: A61K 9/70, A61K 31/325

Značky: antioxidantu, farmaceutická, kompozície, stabilizáciu, kompozícia, použitie, obsahom, tejto

Zhrnutie / Anotácia:

Farmaceutická kompozícia na transdermálnu aplikáciu obsahuje (S)-N-etyl-3-[(1-dimetylamino)etyl]-N-metylfenylkarbamát vo forme voľnej zásady alebo adičnej soli s kyselinou a antioxidant.

Použitie tioflavínových rádioaktívne označených derivátov pri zobrazovaní amyloidu na vyhodnotenie anti-amyloidných terapií

Načítavanie...

Číslo patentu: E 14941

Dátum: 01.07.2005

Autori: Klunk William, Mathis Chester Jr

MPK: A61K 51/04, A61P 25/28

Značky: anti-amyloidných, použitie, terapii, tioflavínových, zobrazování, radioaktivně, derivátov, označených, vyhodnotenie, amyloidu

Text:

...je usporiadaný v prevažujúcej konfigurácii beta-zloženého listu.0004 Predpokladá sa, že AD zasahuje asi 4 milióny Američanov a snád 2030 miliónov ľudí po celom svete. AD je pokladaná za vážny zdravotný problém v rozvinutých krajinách. Z prebiehajúceho objasňovania molekulárneho základuAD vzniklo niekoľko terapeutických cieľov. Napríklad štyri inhibítory cholínesterázy boli schválené pre symptomatické liečenia pacientov sAD takrin (Cognex,...

Kopolyméry s obsahom sulfoskupín rozpustené vo vode, spôsob ich výroby a ich použitie

Načítavanie...

Číslo patentu: E 7093

Dátum: 30.06.2005

Autori: Friedrich Stefan, Schinabeck Michael, Holland Uwe, Pfeuffer Thomas, Eberwein Michael, Schuhbeck Thomas

MPK: C08F 220/00

Značky: sulfoskupin, kopolymery, výroby, rozpuštěné, spôsob, použitie, vodě, obsahom

Text:

...pripadne terpolyméry na báze kyseliny 2-akrylamido-2-metylpropánsulfónovej. Tieto polyméry sú optimalizované na špeciálne požiadavky použitia vo vrtoch. Pri použití v zmesiach stavebných materiálov ako sú malta a betón pripadne náterové a povlakové systémy na báze vody vykazujú pre užívateľa nevýhody, pretože buďsilno obmedzujú vlastnosti tečenia, nedochádza kzamedzeniu odlučovaniaprebytočnej vody z procesu vytvrdzovania alebo schopnosť...

Použitie trisubstituovaných benzopyranónov

Načítavanie...

Číslo patentu: E 5205

Dátum: 30.06.2005

Autori: Schötz Karl, Koch Egon, Hauer Hermann, Germer Stefan

MPK: C07D 311/00

Značky: trisubstituovaných, použitie, benzopyranónov

Text:

...(A. Bendich (1994) vz B.Frei (editor) Natural Antioxidants in Human Health and Disaasa, Academic Press, San Diego, str. 447 E.Peterhans(editori) Antioxidants in Human Health, CAB International,str. 1).0006 Na ochranu proti škodlivým vplyvom voľných radikálov a ROSdisponuje organizmus rôznymi ochrannými systémami. Takýmito látkamisú okrem iných vitamíny (napr. vitamíny E a C) a iné nizkomolekulárne zlúčeniny (napr. glutationy, kyselina...