Patenty so značkou «použitie»

Strana 36

Cykloalkánopyrolokarbazolové deriváty a ich použitie ako inhibítorov PARP, VEGFR2 a MLK3

Načítavanie...

Číslo patentu: E 14930

Dátum: 19.06.2007

Autori: Diebold James, Wells Gregory, Dandu Reddeppareddy, Chatterjee Sankar, Dunn Derek, Hudkins Robert, Zulli Allison

MPK: A61K 31/437, A61P 43/00

Značky: použitie, deriváty, inhibítorov, cykloalkánopyrolokarbazolové, vegfr2, parp

Text:

...polymérov, EP 2 066 324 34 649/Hako bolo stanovené pomocou imunohistochémie. Podobne 3-AB (10 mg/kg) výrazne znížil objem infarktu v modeli fokálnej ischémie u potkanov vyvolanej oklúziou pomocou sutúry (Lo a kol. Stroke 1998, 29, 830). Neuroprotektívny účinok 3-AB (3-30 mg/kg), i.c.v.) bol taktiež pozorovaný v modeli ischémie u potkanov vyvolanej permanentnou oklúziou prostrednej cerebrálnej artérie0007 Dostupnosť myší, u...

Tricyklická zlúčenina a jej farmaceutické použitie

Načítavanie...

Číslo patentu: E 17681

Dátum: 18.06.2007

Autori: Hoashi Yasutaka, Koike Tatsuki, Uchikawa Osamu, Takai Takafumi

MPK: A61K 31/423, A61K 31/425, A61K 31/4184...

Značky: farmaceutické, tricyklická, použitie, zlúčenina

Text:

...1,2 disubstituovanú cyklopropylovú skupinu m znamená l alebo 2 a n znamená l až 9, ktorá má añnitu k melatoninovćmu receptoru a je užitočné ako terapeutické činidlo pre poruchy súvisiace s denným rytmom.0005 US patent č. 6 034 239 opisuje zlúčením reprczentovanú vzorcomv ktorom R znamená prípadne substituovanú uhľovodíkovú skupinu, pripadne substítuovanú aminovťi skupinu alebo prípadne substituovanťl heterocyklickú skupinu R 2 znamená atóm...

Rekombinantné novirhabdovírusy a ich použitie

Načítavanie...

Číslo patentu: E 17224

Dátum: 15.06.2007

Autori: Koumans Joseph, Bremont Michel, Harmache Abdallah

MPK: C12N 15/85

Značky: použitie, rekombinantné, novirhabdovírusy

Text:

...oblasti medzi M a G génmi IHNV. Konkretnejšie, pretože tento gén sa vložil v prirodne sa vyskytujúcom Eagľ reštrikčnom mieste umiestnenom medzi koncom M ORF a transkričným terminálnym signálom M génu, tento konštruktobsahoval sekvenciu (CCAAGACAGAAAAAAATGGCAC SEQ ID NO l)(CCAAGACAGAAAAAAA SEQ ID NO 2), nasledoval ne-transkribovaný intergénový dinukleotid TG a transkripčná iniciačná sekvencia GCAC, po uvedenej sekvencii bezprostredne...

Veľkoplošné geomriežky s vysokou pevnosťou v ťahu, spôsob ich výroby, zariadenie na ich výrobu a ich použitie

Načítavanie...

Číslo patentu: 285738

Dátum: 14.06.2007

Autori: Heerten Georg, Uehlemann Werner, Müller Volkhard, Priewich Stephan

MPK: B29D 28/00, B29C 70/00, B29C 65/06...

Značky: velkoplošné, vysokou, pevnosťou, použitie, zariadenie, výroby, geomriežky, výrobu, spôsob, ťahu

Zhrnutie / Anotácia:

Pri spôsobe kontinuálnej výroby veľkoplošných geomriežok z krížiacich sa termoplastických pruhov sú tieto veľkoplošné geomriežky v oblastiach prekríženia navzájom spojené zvarením. Použité sú jednovrstvové, homogénne plastové pruhy s orientovanými molekulami a s vysokou pevnosťou v ťahu, pričom veľký počet za sebou a vedľa seba usporiadaných oblastí prekríženia sa v taktovanom procese zvarí súčasne s použitím techniky vibračného zvárania....

Deriváty purínu, spôsob ich prípravy, farmaceutická kompozícia, ktorá ich obsahuje, a ich použitie

Načítavanie...

Číslo patentu: 285730

Dátum: 14.06.2007

Autori: Le Grand Darren Mark, Collingwood Stephen Paul, Hayler Judy, Menear Keith Allan, Mattes Henri, Walker Clive Victor, Cockcroft Xiao-ling

MPK: A61K 31/519, C07D 473/00

Značky: použitie, přípravy, spôsob, kompozícia, purinů, farmaceutická, deriváty, obsahuje, ktorá

Zhrnutie / Anotácia:

Opisujú sa deriváty purínu všeobecného vzorca (I) vo voľnej forme alebo vo forme soli, spôsob ich prípravy a farmaceutická kompozícia, ktorá ich obsahuje, a ich použitie na prípravu liečiva na liečenie zápalových alebo obštrukčných ochorení dýchacích ciest.

Zlúčenina derivátov cyklických amínov a jej použitie

Načítavanie...

Číslo patentu: 285729

Dátum: 13.06.2007

Autori: Morita Takuya, Sudoh Masaki, Moree Wilna, Kataoka Ken-ichiro, Muroga Yumiko, Endo Noriaki, Tsutsumi Takaharu, Shiota Tatsuki, Teig Steven, Furuya Monoru, Sogawa Ryo, Imai Minoru, Takenouchi Osami, Hada Takahiko, Tarby Christine

MPK: A61P 11/00, A61K 31/435, A61K 31/41...

Značky: cyklických, použitie, derivátov, zlúčenina, amínov

Zhrnutie / Anotácia:

Zlúčenina všeobecného vzorca (I), jej farmaceuticky prijateľná adičná soľ vzniknutá adíciou kyseliny alebo jej farmaceuticky prijateľná soľ vzniknutá adíciou C1-C6 alkylovej skupiny k tejto zlúčenine a jej použitie na prípravu liečiva na inhibíciu väzby chemokínov, ako sú MIP-1alfa a/alebo MCP-1, k ich receptorom na cieľových bunkách.

Použitie imidazolových derivátov aktivujúcich AMPK, spôsoby ich prípravy a farmaceutické kompozície, ktoré ich obsahujú

Načítavanie...

Číslo patentu: E 10071

Dátum: 12.06.2007

Autori: Marais Dominique, Hallakou-bozec Sophie, Charon Christine, Moinet Gérard

MPK: A61P 3/10, A61P 3/00, A61K 31/4164...

Značky: imidazolových, přípravy, použitie, derivátov, aktivujúcich, spôsoby, kompozície, obsahujú, farmaceutické, ampk

Text:

...the energy charge hypothesis revisited, Bioassays,23, (2001), 1112 Kemp B. E. et al., AMP-activated proteinTransactions, 31, (2003), 162 Musi N. a Goodyear L. J.,Taroeting the AMP-activated protein kinase for the treatment of type 2 diabetes, Current Drug Targets-Immune, Endocrine and Metabolic Disorders, 2, (2002), 119). V priebehu stimulácie AMPK oolo napríklad. preukázané zníženie expresie glukóza-6-fosfatázy (Lochhead P. A. et al.,...

Použitie adenovírusového génového nosiča schopného indukovať apoptózu v bunke na prípravu liečiva na liečenie transformovaných buniek a na prípravu diagnostického prostriedku na diagnostikovanie transformovaných buniek

Načítavanie...

Číslo patentu: 285724

Dátum: 11.06.2007

Autori: Noteborn Matheus Hubertus Maria, Pietersen Alexandra Maria

MPK: C07K 14/005, C12N 15/34, A61K 48/00...

Značky: diagnostického, bunke, adenovírusového, liečivá, indukovať, diagnostikovanie, génového, nosiča, prostriedku, přípravu, apoptózu, použitie, transformovaných, schopného, liečenie, buniek

Zhrnutie / Anotácia:

Je opísané použitie adenovírusového génového nosiča schopného indukovať apoptózu v bunke, obsahujúceho molekulu nukleovej kyseliny, kódujúcu aktivitu podobnú apoptínu, na prípravu liečiva na liečenie transformovaných buniek, pričom apoptóza je vyvolaná v týchto transformovaných bunkách a nastáva redukovaná apoptóza, ak vôbec nejaká, v normálnych diploidných, netransformovaných/nemalígnych bunkách, pričom transformované bunky sú charakterizované...

Použitie zlúčeniny, ktorá inhibuje interakciu medzi LT-ß a jeho receptorom, na výrobu farmaceutického prostriedku

Načítavanie...

Číslo patentu: 285725

Dátum: 08.06.2007

Autori: Thorbecke Jeanette, Browning Jeffrey, Tsiagbe Vincent

MPK: A61K 35/12, A61K 39/395, A61K 38/00...

Značky: farmaceutického, použitie, výrobu, zlúčeniny, ktorá, lt-ß, inhibuje, prostriedku, medzi, receptorom, interakciu

Zhrnutie / Anotácia:

Opisujú sa farmaceutické prípravky obsahujúce inhibítory lymfotoxínovej signálnej dráhy. Tieto prípravky sú užitočné na liečenie nádorov, najmä folikulárnych lymfómov.

1,3-Disubstituované 4-metyl-1H-pyrol-2-karboxamidy a ich použitie na výrobu liečiv

Načítavanie...

Číslo patentu: E 9150

Dátum: 08.06.2007

Autori: Oberbörsch Stefan, Bijsterveld Edward, Hennies Hagen-heinrich, Sundermann Bernd, Sundermann Corinna

MPK: C07D 207/40, C07D 403/12, C07D 401/12...

Značky: výrobu, použitie, 1,3-disubstituované, liečiv, 4-metyl-1h-pyrol-2-karboxamidy

Text:

...(tlenyl), benzyl a fenetyl, kde cyklické substituenty alebo cykllcké zvyšky týchto substituentov môžu byt samotné zakaždým nesubstituované alebo substituované 1, 2, 3, 4 alebo 5 substltuentami od seba nezávisle vybratými zo skupiny pozostávajúcej zF, Cl, Br, l, -CN, -NO 2, -OH, -SH, -NHg, -C(O)-OH,-C 1.5-aIky|, -(CH 2)-O-C 1.5-alkyl, -Cgő-alkenyl, -Czg-alkjnyl, -CEC-Si(CH 3)3, -CECSi(C 2 H 5)3, -S-Cps-alkyl, -S-fenyl,...

FKBP-L a jeho použitie ako inhibítory angiogenézy

Načítavanie...

Číslo patentu: E 19751

Dátum: 08.06.2007

Autori: O'rourke Martin, Valentine Andrea, Hirst David, Robson Tracy

MPK: A61K 31/7105, A61K 38/17, A61P 27/02...

Značky: inhibitory, použitie, angiogenézy, fkbp-l

Text:

...R., Hirst, D. G., Joiner,M. C, Arrand, J. E., (1997) Biochemical J. Transactions 25, 335-341). Preukázalo sa aj to, že potlačenie (repression) génu FKBP-L môže chrániť pred oxidatívnym bunkovým poškodením indukovaným röntgenovým žiarením a UV žiarením (Robson, T., Joiner, M. C, McCullough, W.,Price, M. E., McKeown, S. R., Hirst, D. G. (1999) Radiation Research 152, 451-461 Robson, T.,Price, M. E., Moore, M. L., Joiner, M. C, McKelvey-Martin,...

Rozpúšťadlová sústava pre prípravu roztokov N-alkyltriamidov kyseliny tiofosforečnej, kompozícia s obsahom N-alkyltriamidu kyseliny tiofosforečnej a jej použitie

Načítavanie...

Číslo patentu: E 10550

Dátum: 07.06.2007

Autor: Cigler Petr

MPK: C05C 9/00, C07F 9/22, C07C 43/11...

Značky: n-alkyltriamidu, použitie, kompozícia, rozpúšťadlová, sústava, roztokov, obsahom, kyseliny, n-alkyltriamidov, tiofosforečnej, přípravu

Text:

...a používa sa v podobných koncenlráclách napr. v lekárstve ako aditívum do očných kvapiek.0015 Na indikáciu homogenity potiahnutia tuhého hnojiva obsahujúceho močovinu (napr. granulovanej močoviny) roztokom N-alkyl triamidu kyseliny tiofosforečnej je možné do rozpúšťadlovej sústavy pridať bežné poľnohospodárske alebo potravinárske farbivá.0016 Na dosiahnutie dostatočného pokrytia povrchu tuhého hnojlva obsahujúceho močovinu(napr. granulovanej...

Nový chirálny medziprodukt, spôsob jeho výroby a jeho použitie pri výrobe tolterodinu, fezoterodinu alebo ich aktívneho metabolitu

Načítavanie...

Číslo patentu: E 16351

Dátum: 06.06.2007

Autor: Meese Claus

MPK: A61K 31/353, C07D 311/20

Značky: výroby, fezoterodinu, tolterodínu, použitie, spôsob, chirálny, nový, medziprodukt, výrobe, metabolitu, aktívneho

Text:

...nutkavej močovej inkontinencie, nutkaní a frekvencie močenia, rovnako ako hyperaktivity detruzoru (ako je opísané v USA patente 6 713 464). Tolterodin je iné, dobre známe liečivo na liečenie nadmerne aktívneho močového mechúra.0008 V USA patente č. 6 713 464 a V spise W 0 01/96279 sú opísané dve rôzne cesty syntézy fenolických monoesterov vzorca(III), ako je fezoterodín. spis W 0 01/49649 opisuje istý spôsob vyrábania tolterodínu.0009 Z...

Tlaková vírová atomizačná dýza na striekanie vytvrditeľnej látky a s ňou spojený spôsob a použitie

Načítavanie...

Číslo patentu: E 14128

Dátum: 04.06.2007

Autori: Vermeire Christophe, Benoit Kristof

MPK: B29K 75/00, B05B 1/34, B29C 41/36...

Značky: spôsob, tlaková, dýza, vírová, spojený, striekanie, atomizačná, použitie, látky, vytvrditeľnej

Text:

...v praxi u polyuretánových reakčných zmesí. 0007 Prvou nevýhodou väčšej veľkosti kvapiek je to, že v striekanej vrstve budú obsiahnuté väčšie vzduchové bubliny, čo povedie k horším mechanickým vlastnostiam. Ďalšou nevýhodou je to, že vzor striekania vytváraný väčšími kvapkami je menej stabilný a bude ľahšie narušený gravitáciou alebo vzdušnými prúdmi, takže bude treba striekať silnejšiu vrstvu na získanie rovnomernej vrstvy s požadovanými...

Použitie alopurinolu pri liečbe palmárno-plantárnej erytrodyzestézie

Načítavanie...

Číslo patentu: E 7113

Dátum: 31.05.2007

Autor: Rodemer Yolanda

MPK: A61P 17/00, A61K 31/519

Značky: palmárno-plantárnej, erytrodyzestézie, liečbe, alopurinolu, použitie

Text:

...liečba pri zhubných nádoroch prsníka i pri kolorektálnych zhubných nádoroch a zhubných nádoroch žalúdka a pankreasu. Prinosy chemoterapie využívajúcej fluóruracil ako prídavnú látku sú všeobecne uznávané, najmä čo sa týka tretieho štádia ochorenia, ide najmä o zníženie rizika opätovného výskytu ochorenia a o predĺženie života pacientov, ktorým bol zhubný nádor hrubého čreva odstránený resekciou. Prínosy z hľadiska prežitia sa...

Použitie derivátu pleuromutilínu na liečenie veterinárneho ochorenia

Načítavanie...

Číslo patentu: 285711

Dátum: 30.05.2007

Autori: Burch David George Sidney, Zeisl Erich, Ripley Paul Howard

MPK: A61K 31/21, A61P 31/00

Značky: veterinárneho, derivátů, ochorenia, pleuromutilinů, použitie, liečenie

Zhrnutie / Anotácia:

Opisuje sa použitie derivátu pleuromutilínu vzorca (I), t. j. valnemulínu, vo forme voľnej bázy alebo veterinárne prijateľnej soli na prípravu liečiva na liečenie kolitídy ošípaných spojenej s infekciou vyvolanou mikroorganizmom Serpulina pilosicoli. Opísané je tiež použitie valnemulínu vo forme voľnej bázy alebo veterinárne prijateľnej soli pri liečení ďalších veterinárnych ochorení, ktorých expresia je zvýšená rastúcou hustotou chovu.

Použitie derivátov pyridazino[4,5-b]indol-1-acetamidu na prípravu liečiva na choroby spojené s dysfunkciou benzodiazepínových receptorov periférneho typu

Načítavanie...

Číslo patentu: 285707

Dátum: 30.05.2007

Autori: Evanno Yannick, Janiak Philip, Froissant Jacques, Ferzaz Badia, Sevrin Mireille, Marabout Benoit, Benavides Jésus, Marguet Frank

MPK: A61P 13/00, A61K 31/5375, A61K 31/5025...

Značky: periférneho, použitie, přípravu, benzodiazepínových, receptorov, spojené, pyridazino[4,5-b]indol-1-acetamidu, derivátov, dysfunkciou, liečivá, choroby

Zhrnutie / Anotácia:

Opisuje sa použitie zlúčeniny všeobecného vzorca (I), v ktorom X znamená atóm halogénu, Y znamená jeden alebo viac atómov alebo skupín vybraných zo súboru, ktorý pozostáva z atómu vodíka, atómov halogénov, hydroxylovej skupiny, metylovej skupiny, metoxyskupiny a nitroskupiny, R1 znamená alkylovú skupinu s 1 až 4 atómami uhlíka, R2 a R3 sú vždy navzájom nezávisle atóm vodíka alebo alkylová skupina s 1 až 4 atómami uhlíka alebo alternatívne R2 a...

Lisovaná tabletová kompozícia, spôsob jej prípravy a jej použitie

Načítavanie...

Číslo patentu: 285706

Dátum: 30.05.2007

Autori: Rhoades Tracey Jane, Sherry Robert Arthur, Higton Frederick Raymond

MPK: A61K 31/185, A61K 47/02, A61K 47/36...

Značky: tabletová, kompozícia, spôsob, lisovaná, použitie, přípravy

Zhrnutie / Anotácia:

Lisovaná tabletová kompozícia obsahujúca granulovanú zložku obsahujúcu množstvo stuhnutých tavených granúl nesteroidného protizápalového liečiva s teplotou topenia v rozsahu 30 až 300 °C a obsahujúcu v sebe rovnorodo dispergované rozvoľňovadlo. Granuly obsahujú kontinuálnu fázu protizápalového liečiva a tabletová kompozícia obsahuje oxid kremičitý prítomný v množstve 0,05 až 5 % hmotn. Je opísaný aj spôsob prípravy kompozície a jej použitie na...

Aminotiazolové deriváty a ich použitie ako antibakteriálne činidlá

Načítavanie...

Číslo patentu: E 15742

Dátum: 30.05.2007

Autori: Bushell Simon, Whitehead Lewis, Patane Michael, Lamarche Matthew

MPK: C07K 5/06, A61P 31/00, A61K 38/00...

Značky: činidla, aminotiazolové, použitie, antibakteriálně, deriváty

Text:

...september, 33 Suppl. 3, 108115) rovnako ako Staphylococcus, Streptococcus, Mycobacterium, Enterococcus, Corynebacterium, Borrelía, Bacillus, Chlamydia, Mycoplasma a podobne.Problémom podobného významu je zvyšujúca sa incidencia virulentnejšieho,meticilin-rezistentného Staphylococcus aureus (MRSA) z klinických izolátov a to celosvetovo. Rovnako ako pri organizmoch rezistentnýeh na vankomycín, je mnoho kmeňov MRSA rezistentnýeh voči mnohým...

Protilátky a imunokonjugáty a ich použitie

Načítavanie...

Číslo patentu: E 15870

Dátum: 29.05.2007

Autori: Ebens Allen, Yu Shang-fan, Wu Yan, Gray Alane, Liang Wei-ching

MPK: A61K 47/48, C07K 16/28

Značky: imunokonjugáty, použitie, protilátky

Text:

...(2003) Nature Biotechnology 21(7)778-784 Monomethylvaline Compounds Capable of Conjugation to Ligands Francisco a spol. (2003) Blood 102(4)1458-1465 US 2004/0018194 (iii) anti-CD 20 protilátkami, ako je napríklad Rituxan® (rituximab) (W 0 04/032828), na liečenie CD 20-exprimujúcich typov rakoviny a imunitných porúch (iv) anti-EphB 2 protilátkami 2 H 9 a anti-IL-8 na liečenie kolorektálnej rakoviny (Mao a spol. (2004) Cancer Research...

Anti-CD22 protilátky, ich imunokonjugáty a ich použitie

Načítavanie...

Číslo patentu: E 19104

Dátum: 29.05.2007

Autori: Wu Yan, Gray Alane, Yu Shang-fan, Ebens Allen, Liang Wei-ching

MPK: A61K 47/48, A61K 45/06, A61K 39/395...

Značky: protilátky, imunokonjugáty, anti-cd22, použitie

Text:

...Bioconjugate Chemistry 15(4)765-773 Doronina a spol. (2003) Nature Biotechnology 21(7)778-784 Monomethylvaline Compounds Capable of Conjugation to Ligands Francisco a spol. (2003) Blood 102(4)1458-1465 US 2004/0018194 (iii) anti-CD 20 protilátkami, ako je napríklad Rituxan® (rituximab) (W 0 04/032828), na liečenie CD 20-exprimujúcich typov rakoviny a imunitných porúch (iv) anti-EphB 2 protilátkami 2 H 9 a anti-IL-8 na liečenie...

Tri a tetra-oligo-sacharidy na použitie ako aglutinačné činidlá na črevné patogény

Načítavanie...

Číslo patentu: E 19020

Dátum: 29.05.2007

Autori: Deschepper Katrien, Bruggeman Geert

MPK: A61K 31/702, A23L 1/09, A61P 1/12...

Značky: činidla, tetra-oligo-sacharidy, aglutinačné, črevné, patogény, použitie

Text:

...rastlinné extrakty (esenciálne oleje) (De Koning and Hongbiao, 1999 Nielsen, 1999).0006 V dnešnej dobe sa už používa niekoľko typov oligosacharidov v rôznych aplikáciách. Vniektorých ztýchto aplikácií sú oligosacharidy0007 WO 2006022542 nárokuje kombinované použitie nestráviteIných oligosacharidov a stráviteIného galaktózového sacharidu na výrobu prípravkov na použitie v spôsobe liečby a/alebo prevencie infekčných ochorení respiračného traktu,...

(-)-5-(3-Chlórfenyl)-alfa-(4-chlórfenyl)-alfa-(1-metyl-1H-imidazol-5- yl) tetrozolo[1,5-a]chinazolín-7-metánamín, spôsob jeho prípravy a použitie, farmaceutický prípravok na jeho báze a spôsob jeho prípravy

Načítavanie...

Číslo patentu: 285699

Dátum: 28.05.2007

Autori: End David William, Venet Marc Gaston, Angibaud Patrick René

MPK: C07D 239/00, A61P 35/00, A61K 31/519...

Značky: použitie, báze, přípravy, spôsob, 5-(3-chlórfenyl)-alfa-(4-chlórfenyl)-alfa-(1-metyl-1h-imidazol-5, farmaceutický, tetrozolo[1,5-a]chinazolín-7-metánamín, prípravok

Zhrnutie / Anotácia:

Opisuje sa (-)-5-(3-chlórfenyl)-alfa-(4-chlórfenyl)-alfa-(1-metyl-1H-imidazol-5- yl) tetrozolo[1,5-a]chinazolín-7-metánamín a jeho farmaceuticky prijateľné adičné soli s kyselinami, spôsob ich prípravy oddelením z príslušnej racemickej zmesi a použitie v lekárstve, najmä na liečenie rakoviny. Ďalej je opísaný farmaceutický prípravok s obsahom niektorej z týchto látok a spôsob jeho prípravy miešaním.

Použitie monoester probukolu s kyselinou jantárovou na liečenie kardiovaskulárnych a zápalových ochorení

Načítavanie...

Číslo patentu: 285695

Dátum: 28.05.2007

Autor: Somers Patricia

MPK: A61P 19/00, A61P 17/00, A61K 31/21...

Značky: monoester, kardiovaskulárnych, kyselinou, probukolu, jantarovou, ochorení, použitie, liečenie, zápalových

Zhrnutie / Anotácia:

Opísané je použitie monoesteru probukolu s kyselinou jantárovou, ktorý pôsobí inhibične na expresiu VCAM-1, na výrobu liečiva na liečenie kardiovaskulárnych ochorení, ako sú ateroskleróza, restenóza po angioplastike, koronárne ochorenie artérií, angína pektoris, ochorenia drobných ciev, alebo zápalových ochorení, ako sú ľudská endoteliálna porucha, astma, psoriáza, ekzémová dermatitída, Kaposiho sarkóm, skleróza multiplex, proliferačná porucha...

Separačný prostriedok a jeho použitie pri výrobe polyuretánových tvárnených telies

Načítavanie...

Číslo patentu: E 4173

Dátum: 26.05.2007

Autor: Henning Torsten

MPK: C08K 5/00, B29C 33/56

Značky: použitie, polyuretánových, separačný, výrobe, telies, tvárnených, prostriedok

Text:

...separačne účinných látok, ako sú vosky,mydlá, oleje a/alebo silikón, v organických rozpúšťadlách spoločne so soľami bizmutu a organických kyselín v množstvách 0,05 až 10 hmotn., výhodne 0,1 až 5 hmotn,, najmä 0,2 ažPredmetom vynálezu sú preto disperzie separačných prostriedkov pre výrobu polyuretáno vých tvámených telies obsahujúce hlavneA) aspoň jeden separačne účinný prostriedok zo skupiny mydiel, olejov, voskov a silikó IIOV aB) aspoň...

2-Alkoxy-3,4,5-trihydroxyalkylamidbenzotiazepíny, ich príprava, kompozície, ktoré ich obsahujú a použitie

Načítavanie...

Číslo patentu: E 7468

Dátum: 23.05.2007

Autori: Zhang Jidong, Commerçon Alain, Nardi Frédérico, Benedetti Yannick

MPK: A61P 25/00, A61K 31/4709, A61P 19/00...

Značky: príprava, obsahujú, použitie, kompozície, 2-alkoxy-3,4,5-trihydroxyalkylamidbenzotiazepíny

Text:

...3)2, (E) -CHCH-C(CH 3)3 alebo ešte zo súboru, ktorý zahŕňa (E) C(CH 3)CH-CH(CH 3)(C 2 H 5), (E) -C(CH 3)CH-CH(CH 3)2 a (E) -C(CH 3)CH-C(CH 3)3.Výhodnejšie je R. zvolený zo súboru, ktorý zahŕňa (E) -CHCH-C 5 H 9, (E) -CHCH-C 6 H,(E) -CHCH-(CH 2)3-CH 3, (E) -CHCH-C(,H 5, kde fenyl je prípadne substituovaný atómomV rámci predmetov tohto vynálezu sa prvá skupina vyznačuje tým, že X znamená S. Druháskupina sa vyznačuje tým, že X znamená SO.V...

3-(1,3-Benzodioxol-5-yl)-6-(4-cyklopropylpiperazín-1-yl)-pyridazín, jeho soli a solváty a jeho použitie ako antagonistu histamínového H3 receptora

Načítavanie...

Číslo patentu: E 11259

Dátum: 22.05.2007

Autor: Hohlweg Rolf

MPK: A61K 31/501, C07D 405/04

Značky: 3-(1,3-benzodioxol-5-yl)-6-(4-cyklopropylpiperazín-1-yl)-pyridazín, antagonistu, použitie, histamínového, receptora, solváty

Text:

...famiaoeutický prostriedok vo forme jednotkovej dávky, ktorý obsahuje od okolo 0,05 mg do okolo 1000 mg, napríklad od okolo 0,1 mg do okolo 500 mg, ako je od okolo 0,5 mg až do okolo 200 mg nárokovanej zlúčeniny.0023 Z iného hľadiska vynález zahŕňa použitie nárokovanej zlúčeniny na výrobu lieku na liečbu chorôb a porúch, v ktorých inhiblcia histamínového H 3 receptora má priaznivý účinok.0024 Z iného hladiska vynález zahŕňa použitie nárokovanej...

Použitie kompozície obsahujúcej kombináciu hydrochinónu, acetonidu fluocinolonu a tretinoidu na liečenie príznakov stárnutia kože spôsobeného expozíciou svetlom

Načítavanie...

Číslo patentu: E 13272

Dátum: 21.05.2007

Autor: Hexsel Doris Maria

MPK: A61K 31/57, A61K 31/203, A61K 31/05...

Značky: použitie, liečenie, hydrochinónu, svetlom, starnutia, tretinoidu, spôsobeného, príznakov, obsahujúcej, fluocinolonu, acetonidu, kombináciu, kôže, expozíciou, kompozície

Text:

...označovaná ako solárne lentigo.Difúzna hyperpigmentácia, označovaná anglicky tiež ako mottled hyperpig mentation sa prejavuje difúmou nepravidelnosťou zafarbenia kože.Na koži zostamutej vplyvom žiarenia sa tiež objavujú príznaky aktinickej keratózy tieto väčšinu času asymptomatické lézie môžu byt tiež považované za prekancerózne lézie. Ide o lokalizované hyperkeratózne zhutnenie kože vykazujúce tiež kožné šupiny. Ak sapacient snaží vytrhnúť...

Inhibítory retrovírusových proteáz na báze hydroxyetylaminosulfónamidu aminokyselín a ich použitie

Načítavanie...

Číslo patentu: 285688

Dátum: 18.05.2007

Autori: Sikorski James, Vazquez Michael, Brown David, Nagarajan Srinivasan, Devadas Balekudru, Mcdonald Joseph, Decrescenzo Gary, Freskos John, Getman Daniel

MPK: C07K 5/00, A61K 38/55

Značky: aminokyselin, inhibitory, hydroxyetylaminosulfónamidu, báze, použitie, proteáz, retrovírusových

Zhrnutie / Anotácia:

Vybrané hydroxyetylaminosulfónamidové zlúčeniny aminokyselín všeobecného vzorca (I), ktoré sú účinné ako inhibítory proteáz retrovírusov, osobitne ako inhibítory proteázy vírusu HIV. Sú opísané prípravky ich obsahujúce a spôsoby na potlačenie retrovírusových proteáz, ako je napríklad proteáza vírusu ľudskej imunodeficiencie (HIV), použitie týchto zlúčenín na prípravu liečiva na profylaktickú prevenciu retrovírusovej infekcie alebo šírenia...

Polosyntetické taxány, farmaceutický prostriedok s ich obsahom a ich použitie

Načítavanie...

Číslo patentu: 285683

Dátum: 17.05.2007

Autori: Bombardelli Ezio, Pontiroli Alessandro

MPK: A61P 35/00, A61K 31/337, A61P 19/00...

Značky: obsahom, farmaceutický, použitie, polosyntetické, taxány, prostriedok

Zhrnutie / Anotácia:

Sú opísané zlúčeniny všeobecného vzorca (I), kde symboly majú význam uvedený v nárokoch, farmaceutický prostriedok s ich obsahom a ich použitie na výrobu lieku s protinádorovým, protiangiogenetickým a protiartrózovým účinkom.

2-(1H-Indol-3-yl)-2-oxo-acetamidy, farmaceutický prostriedok s ich obsahom a ich použitie

Načítavanie...

Číslo patentu: 285682

Dátum: 17.05.2007

Autori: Pescalli Nicoletta, Menta Ernesto

MPK: A61K 31/403, A61K 31/407, A61K 31/422...

Značky: prostriedok, obsahom, 2-(1h-indol-3-yl)-2-oxo-acetamidy, použitie, farmaceutický

Zhrnutie / Anotácia:

2-(1H-Indol-3-yl)-2-oxo-acetamidy, ktoré majú protinádorový účinok, všeobecného vzorca (I), kde Y je atóm kyslíka alebo síry a X, R1, R2, R3, R4 a R5 sú definované v patentových nárokoch. Je opísaný aj farmaceutický prostriedok s obsahom 2-(1H-indol-3-yl)-2-oxo-acetamidov a ich použitie na liečenie nádorov.

Guanidínový derivát, jeho použitie a farmaceutický prostriedok s jeho obsahom

Načítavanie...

Číslo patentu: 285685

Dátum: 16.05.2007

Autori: Clark Charles, Dominguez Celia, Pruitt James Russell, Li Renhua, Quan Mimi Lifen, Pinto Donald Joseph Phillip, Han Qi, Lam Patrick, Fevig John Matthew

MPK: C07D 231/00, A61K 31/47, A61K 31/42...

Značky: guanidínový, farmaceutický, derivát, obsahom, prostriedok, použitie

Zhrnutie / Anotácia:

Guanidínový derivát všeobecného vzorca (I), ktorý je užitočný ako inhibítor faktora Xa. Jeho použitie ako liečiva na liečbu tromboembolických chorôb a farmaceutický prostriedok s jeho obsahom.

Derivát benzamidu, liečivo s jeho obsahom a ich použitie

Načítavanie...

Číslo patentu: 285679

Dátum: 16.05.2007

Autori: Kato Hideo, Kado Noriyuki, Sakaguchi Jun

MPK: C07D 211/00, A61P 1/00, A61K 31/4468...

Značky: benzamidu, liečivo, derivát, obsahom, použitie

Zhrnutie / Anotácia:

Opisuje sa derivát benzamidu všeobecného vzorca (I), kde R predstavuje alkylskupinu obsahujúcu 3 až 6 atómov uhlíka alebo jeho soľ a liečivo, ktoré ako účinnú zložku obsahuje uvedenú zlúčeninu a použitie uvedenej zlúčeniny na výrobu liečiva na liečenie alebo prevenciu zažívacích chorôb.

Sekretagógy rastového hormónu, ich použitie, farmaceutické kompozície na ich báze a medziprodukty

Načítavanie...

Číslo patentu: 285678

Dátum: 16.05.2007

Autori: Ragan John, Jardine Dasilva Paul, Lefker Bruce, Carpino Philip

MPK: A61K 38/05, C07D 471/00, A61K 31/395...

Značky: rastového, báze, použitie, medziprodukty, sekretagógy, hormonu, farmaceutické, kompozície

Zhrnutie / Anotácia:

Zlúčeniny všeobecného vzorca (I) a ich farmaceuticky vhodné soli, ktoré sú sekretagógmi rastového hormónu, zvyšujú hladinu endogénneho rastového hormónu, sú užitočné pri liečení a prevencii osteoporózy, kongestívneho srdcového zlyhania, slabosti spojenej so starnutím, obezity, pri urýchľovaní hojenia zlomenín kostí, atenuácii proteínovej katabolickej odpovede po veľkých operáciách, znižovaní kachexie a straty proteínov v dôsledku chronickej...

Použitie zvyškových a/alebo odpadových látok v elektrických nízkošachtových peciach

Načítavanie...

Číslo patentu: E 9236

Dátum: 16.05.2007

Autori: Salzinger Josef, Baumann Leonhard, Möller Roland, Holzrichter Klaus

MPK: F27B 3/08

Značky: zvyškových, použitie, nízkošachtových, odpadových, elektrických, peciach, látok

Text:

...úlohou pretlloženćht) vynailezu zaviesť nové použitie pre zvyškovć a/alebo odpadové látky akoTáto ťiloha bola vyriešené príslušným použitím podľa nároku l, pri ktorom sa zvyškovć a/alcbo odpadové látky použijú na tepelné zhodnotenie a/alebo ako zdroj uhlíka.Prckvapujúco bolo zistené, že v súvislosti podľa vynálezu sú energetické obsahy použitých zvyzškových a odpadových látok pre elektrické nizkošachtové pece v podstate nevýznamné. Taktiež...

Použitie 4,17beta-dihydroxyandrost-4-én-3-ónu na liečenie rakoviny

Načítavanie...

Číslo patentu: E 8755

Dátum: 11.05.2007

Autor: Teichmann Alexander Tobias

MPK: A61K 45/06, A61P 35/00, A61K 31/568...

Značky: liečenie, použitie, 4,17beta-dihydroxyandrost-4-én-3-ónu, rakoviny

Text:

...Cancer Res. (Suppl.) 42, 33270010 Klinické štúdie uskutočňované santagonistami estrogénovéhoreceptora (ER) a inhíbítormi aromatázy však ukázali, že tieto zlúčeniny neboli schopné prejaviť významný a postaćujúci inhibičný účinok na prolíferáciu a/alebo rast nádoru. Napríklad terapia na báze Tamoxifenu® trpí nedostatkami,ako je napríklad tachyfylaxia (zlyhanie terapie) a fakt, že jeho účinky v niektorých bunkách sú podobné estrogénu (napr....

Deriváty piperazinylalkyltiopyrimidínu, spôsob ich prípravy, ich použitie a farmaceutické kompozície s ich obsahom

Načítavanie...

Číslo patentu: 285670

Dátum: 10.05.2007

Autori: Németh Gábor, Jakóczi Iván, Gacsályi István, Rátzné Simonek Ildikó, Tihanyi Károly, Poszávácz László, Wellman János, Egyed András, Lévay György, Bózsing Dániel, Simig Gyula

MPK: A61K 31/505, A61K 31/506, A61P 25/00...

Značky: farmaceutické, kompozície, deriváty, použitie, spôsob, piperazinylalkyltiopyrimidínu, obsahom, přípravy

Zhrnutie / Anotácia:

Opísané sú deriváty piperazinylalkyltiopyrimidínu všeobecného vzorca (I), spôsoby ich prípravy, farmaceutické kompozície s ich obsahom a ich použitie na prípravu liečiv pôsobiacich na centrálny nervový systém, najmä anxiolytických liečiv.

Ekteinascidínová zlúčenina, farmaceutický prostriedok s jej obsahom a jej použitie

Načítavanie...

Číslo patentu: 285669

Dátum: 10.05.2007

Autori: Morales Jose, Rinehart Kenneth

MPK: A61K 31/4995, A61K 31/50, A61K 31/495...

Značky: farmaceutický, obsahom, prostriedok, použitie, zlúčenina, ekteinascidínová

Zhrnutie / Anotácia:

Opísané sú ekteinascidínové zlúčeniny označené ako Et 757 a Iso-Et 743, farmaceutické prostriedky s ich obsahom a ich použitie na prípravu liečiv na liečenie cicavčej leukémie, cicavčieho melanómu a cicavčieho pľúcneho karcinómu.

Spôsob detekcie in vivo aktivity neurotrypsínu, použitie tohto spôsobu a C-koncového 22-kDa fragmentu agrínu ako biomarkera pri diagnóze a sledovaní porúch súvisiacich s neurotrypsínom

Načítavanie...

Číslo patentu: E 8178

Dátum: 10.05.2007

Autori: Stephan Alexander, Kunz Beat, Miyai Kazumasa, Sonderegger Peter, Hettwer Stefan

MPK: C12Q 1/37

Značky: agrínu, neurotrypsínom, diagnóze, spôsob, neurotrypsínu, spôsobu, biomarkera, c-koncového, sledování, fragmentu, 22-kda, tohto, detekcie, súvisiacich, aktivity, použitie, poruch

Text:

...aktivitu neurotrypsínu.0012 Výhodné uskutočnenia vynálezu sú uvedené v závislých nárokoch.Obrázok l ukazuje proteinovú sekvenciu ľudského agrínu (SEQ ID NO l). Celá dĺžka nespracovaného prekurzora činí 2045 aminokyselín. V časti sekvencie je označená poloha a- a B-štepiacich miest. Ďalej sú označené niektoré podsekvencie, na ktoré je odkazovanéV príkladoch. Sekvencia 22-kDa fragmentu agrínu je uvedená veľkými písmenami.Obrázok 2 A je...

Použitie flibanserínu na liečbu postmenopauzálnych porúch sexuálnej túžby

Načítavanie...

Číslo patentu: E 19682

Dátum: 07.05.2007

Autori: Pollentier Stephane, Pyke Robert

MPK: A61P 15/00, A61P 15/12, A61K 31/496...

Značky: postmenopauzálnych, flibanserinu, liečbu, túžby, sexuálnej, poruch, použitie

Text:

...žien V postmenopauze, ktorá bola prítomná od začiatku sexuálneho života a výraz získaná postmenopauzálna porucha sexuálnej túžby sa vzťahuje na hypoaktívnu poruchu sexuálnej túžby u žien v postmenopauze, ktorá sa vyvinula po určitom čase normálneho sexuálneho života. Hoci sa môže zdať, že V slovnej formulácii celoživotné postmenopauzálna je zjavný rozpor, malo by sa jej rozumieť ako poruche diagnostikovanej po menopauze, pri ktorej história...