Patenty so značkou «podobného»

Analógy peptidu-1 podobného glukagónu

Načítavanie...

Číslo patentu: 287757

Dátum: 27.07.2011

Autori: Millican Rohn Lee, Glaesner Wolfgang

MPK: A61K 38/26, A61K 38/00, A61P 1/04...

Značky: peptidu-1, glukagónu, analogy, podobného

Zhrnutie / Anotácia:

Sú opísané GLP-1 zlúčeniny obsahujúce sekvenciu aminokyselín SEQ ID NO: 1, SEQ ID NO: 2 alebo SEQ ID NO: 3 na použitie ako liečivo na liečenie od inzulínu nezávislého diabetu, na profylaktické ošetrenie od inzulínu nezávislého diabetu alebo na použitie na liečenie obezity, mŕtvice, infarktu myokardu, katabolických pooperačných zmien alebo syndrómu dráždivého čreva.

Spôsob a zariadenie na výrobu vláknitých, MDF, HDF, drevných alebo plastových dosiek z vlákien alebo materiálu podobného vláknam

Načítavanie...

Číslo patentu: E 15741

Dátum: 29.01.2010

Autor: Von Haas Gernot

MPK: B27N 1/02, B01F 5/04

Značky: vláknitých, dosiek, spôsob, vlákien, výrobu, drevných, plášťových, zariadenie, materiálů, podobného, vláknam

Text:

...vďačni za malé zákazky, aby zaistili vyťaženie produkcie V rytme 24/7. Na základe toho už nie je bežné viaceré hodiny alebo dokonca dni spracovávať rovnaký druh produktu, ale viackrát denne sa mení hrúbkaprodukcie a/alebo hustota produkcie vyrábaných materiálových dosiek. To znamená, že sapravidelne prispôsobujú prietokové množstvá vlákien v transportnej rúre na potrebnéAž do času surovinovej krízy pri tomto nebolo dôležité, či sa nanesenie...

Zariadenie zlepšujúce tok pekárenského, lístkového alebo podobného cesta po stene násypky

Načítavanie...

Číslo patentu: E 19035

Dátum: 17.03.2009

Autor: Zorn Bernard

MPK: A21C 5/00, A21C 3/04

Značky: podobného, pekárenského, zariadenie, lístkového, stěně, zlepšujúce, násypky, cesta

Text:

...na jej naplnenie. Jej rozmery môžu byť značné a počas každéhocyklu delenia cesta môže poskytnúť zvýšený počet menších kúskov cesta. Navyše tento postup delenia, ktorý si nevyžaduje vyvinúť nadmerný tlak na cesto, umožňuje získať výrobky najvyššej kvality.Každý cyklus však naďalej závisí od doby plnenia zásobovacej komory a tým aj tokom cesta vo vnútri násypníka.Na účely skrátenia doby plnenia sa v zariadeniach z predchádzajúcich techník...

Nosník na uchytenie elektromotora k nádrži automatickej pračky alebo podobného domáceho spotrebiča

Načítavanie...

Číslo patentu: E 9787

Dátum: 11.09.2008

Autor: Marioni Elio

MPK: D06F 37/20, D06F 37/30

Značky: podobného, domáceho, spotrebiča, uchytenie, elektromotora, automatickej, nosník, pračky, nádrží

Text:

...dvojitú úlohu- konštrukčnú, pretože takéto výstužné rebrá podporujú uloženie elektromotora- tepelnú, pretože takéto výstužné rebrá sú schopné odvádzať teplo z dosky riadiaceho obvodu, čím pracujú ako teploodvázacie lamely.0017 Vlastnosti a výhody tohto vynálezu budú zrejmé z nasledovného opisu s referenciami na priložené výkresy, ktoré sú uvedené ako názorné a nelimitujúce.Prehľad orázkov na výkresoch 0018 Na výkresoch- obrázok 1 A...

Zariadenie na výrobu aspoň dvojvrstvových výrobkov vyrobených z tissue a/alebo podobného materiálu

Načítavanie...

Číslo patentu: 286354

Dátum: 16.07.2008

Autor: Klappert Ralf

MPK: B31F 1/00

Značky: podobného, výrobu, dvojvrstvových, vyrobených, materiálů, aspoň, tissue, výrobkov, zariadenie

Zhrnutie / Anotácia:

Zariadenie na výrobu aspoň dvojvrstvových výrobkov z tissue a/alebo podobného materiálu s dobrou adhéziou medzi vrstvami obsahuje raziacu jednotku aspoň s dvoma valcami, z ktorých jeden valec je hladký valec (2) a druhý valec je raziaci valec (3). Raziaci valec (3) obsahuje hriadeľ (4) a najmenej dva na ňom usporiadané segmenty (6) vybavené raziacimi prvkami (5), pričom tento valec (3) je vystavený tlaku prostredníctvom aspoň jednej ložiskovej...

Dýzový nástroj a hlava pre držanie nástroja na povrchové obrábanie dosiek a blokov kamenného, cementového alebo podobného materiálu

Načítavanie...

Číslo patentu: E 15809

Dátum: 18.03.2008

Autor: Lovato Claudio

MPK: B24C 1/04, B26F 3/00

Značky: dosiek, cementového, držanie, dýzový, kamenného, nástroj, blokov, povrchové, obrábanie, nástroja, podobného, hlava, materiálů

Text:

...zverejňuje dýzový nástroj na Vysokotlakové médium v súlade s predvýznakovou časťou patentového nároku 1. Obzvlášť uskutočnenie, kde má nástroj dve zoskupenia dýz rozdelených pozdĺž0018 Toto zvláštne usporiadanie spôsobuje nechcený efekt prekrývania vzorov, ktoré sú vytvárané pomocou dvoch alebo viacerých nasledujúcich dýz každého zoskupenia, takže opracovaný povrch je stále ovplyvnený vyššie uvedenými nevýhodami.0019 Cieľom predloženého...

Spôsob výroby tissue a/alebo materiálu podobného tissue

Načítavanie...

Číslo patentu: 286060

Dátum: 21.01.2008

Autor: Klappert Ralf

MPK: B31F 1/00, D21H 25/00, D21H 27/00...

Značky: tissue, materiálů, výroby, spôsob, podobného

Zhrnutie / Anotácia:

Tissue a/alebo materiál podobný tissue so zlepšenými vlastnosťami a/alebo absorpčnou schopnosťou na výrobu toaletného papiera, vreckoviek, kuchynských roliek a podobne, ktorý je vybavený na časti najmenej jedného svojho povrchu množstvom mikrotrhliniek, ktoré sú otvorené smerom k povrchu. Pri výrobe tohto materiálu sa pás (7) materiálu vedie do zariadenia (1) s nástrojom na tvorbu trhliniek, potom sa pás (7) materiálu medzi bokmi (4.1, 4.2)...

Stabilizované polypeptidy rastového faktora podobného inzulínu

Načítavanie...

Číslo patentu: E 18779

Dátum: 06.06.2007

Autori: Glass David Jonathan, Fornaro Mara

MPK: A61K 38/30

Značky: rastového, podobného, polypeptidy, faktora, stabilizované, inzulínu

Text:

...zabránené napr. mutáciou či delécíou buď arginínu v pozícii 1, alebo serínu v pozícii 2 E-peptidov (zodpovedajúcich pozíciám 71 a 72 v natívnom prekurzore IGF-l). V IGF-2 sa štíepeniu zabráni napr. mutáciou či deléciou bud arginínu v pozícii 1, alebo kyseliny asparágovej v pozícii 2 E-peptidu (zodpovedajúcich pozíciám 68 a 69 V natívnom prekurzore IGF-2). Tomuto štíepeniu môžu zabrániť i ďalšiemodifikácie prekurzorového proteínu IGF.Okrem...

Analógy glukagónu podobného peptidu-2(GLP-2)

Načítavanie...

Číslo patentu: E 9353

Dátum: 04.05.2006

Autori: Larsen Bjarne Due, Ebbehöj Kirsten, Petersen Yvette Miata

MPK: A61K 38/26, C07K 14/605

Značky: glukagónu, analogy, peptidu-2(glp-2, podobného

Text:

...X 3, X 7, X 16, × 24 a × 28. Zíúčeniny so selektívnym účinkom na tenké črevo teda môžu zahrnovat viac ako jednu zo substitúcií X 3 je Glu, X 7 je Ser, X 16 je Ala, X 24 je Ala a X 28 je Ala. Amino-kyselinové zvyšky na pozíciách X 31, × 32 a X 33 môžu byt voliteľne odstránené.0024 Príklady zlúčenín podľa vynálezu, prednostné stimulujúce epiteliáíny rast vtenkom čreve, zahrnujú 1818, 1820, 1844, 1846, 1848, 1849, 1852, 1853, 1855, 1857 a...

Panel z dreva alebo z podobného materiálu, spôsob jeho výroby a zariadenie na výrobu tohto panelu

Načítavanie...

Číslo patentu: E 2862

Dátum: 16.12.2005

Autor: Bernardi Paolo

MPK: B27D 5/00, B27M 1/00

Značky: zariadenie, panel, podobného, výroby, dřeva, tohto, výrobu, materiálů, spôsob, panelu

Text:

...smerom von.Ako vidno na obr. 3, prvok 2 sa potom posúva cez ohraňovaciu jednotku 11,ktorá obsahuje známu ohraňovaciu jednotku 12 na pripevnenie tvarovanej hrany 13 na čelo 7 a (obr. 1) táto hrana má v podstate plochú upevňovaciu časť, ktorá ma v podstate rovnakú plochu ako čelo 7 a, a pripevňuje sa axiálne pomocou dvoch plôch 15 a, 15 b kolmo na os 3. Plocha 15 a je oproti ploche 7 a, a obsahuje v strede spevňovaci výstupok, ktorý axíálne...

Spôsob čistenia lešteného tvrdého podlahového povrchu z kameňa alebo z materiálu podobného kameňu

Načítavanie...

Číslo patentu: E 11476

Dátum: 16.11.2005

Autor: Thysell Hakan

MPK: B24B 7/18, A47L 13/16, B24B 1/00...

Značky: spôsob, tvrdého, podobného, podlahového, kameňa, čistenia, materiálů, povrchu, lešteného, kamenů

Text:

...FIoorPads a nemajú žiadny alebo len veľmi malý účinok na veľmi tvrdých povrchoch, ako je terrazzo alebo betón, ktoré boli používané dlhšiu dobu.0011 EP-B-O 562 919 opisuje netkaný vankúšik z polymérových vlákien,ktorý je celkom impregnovaný spojivom zahŕňajúcim zmes vytvrditelnej plastickej živice a brúsnych častíc s veľkosťou 0,1 až 30 m. Ako príklady vytvrditelných živíc sú zmienené fenolové živice, akrylátové živice, melamínové živice a...

Inhibítory proteínu podobného angiopoetínu 4, kombinácie a ich použitie

Načítavanie...

Číslo patentu: E 7068

Dátum: 19.07.2005

Autori: Liang Xiao Huan, Ferrara Napoleone, Gerber Hans-peter

MPK: C07K 16/00

Značky: proteínu, kombinácie, angiopoetínu, inhibitory, podobného, použitie

Text:

...vynálezu ANGPTL 4 antagonista je molekula SiRNA. Vjednom uskutočnení SiRNA molekula je ANGPTL 4-SiRNA molekula, kde molekula je zameraná na sekvenciu DNA (napriklad GTGGCCAAGCCTGCCCGAAGA, SEQ lD N 03) nukleovej kyseliny kódujúcej ANGPTL 4.0015 Poskytujú sa spôsoby blokovania alebo redukovania rastu nádoru alebo rastu rakovinových buniek. Vurčitých uskutočneniach spôsoby zahŕňajú podávanie účinného množstva antagonistu podobného...

Výroba glukagónu podobného peptidu 2 a analógov

Načítavanie...

Číslo patentu: E 11478

Dátum: 22.11.2004

Autori: Araujo Alberto De, Williamson Vanessa Jane, Walczyk Ewa, Sasaki Ken

MPK: C07K 14/605, A61K 38/26, C12N 15/16...

Značky: peptidů, podobného, glukagónu, výroba, analógov

Text:

...sa vyskytujúcich aminokyselín v sekvencii tvoriacej GLP-2 peptid. S výhodou sú N- a C-koncové zvyšky koncovo autentické. Obzvlášť predkladaný spôsob vedie k požadovanému GLP-2, ako peptidu, ktorý má N- a C-koncové zvyšky, ktoré sú bez zvyškových aminokyselín a ďalších chemických skupín, ktoré sú často dôsledkom rekombinantných spôsobov výroby proteínu, EP 1 704 234 34073/Hobzvlášť tých, ktoré závisia na produkcii proteínu ako fúzovaného...

Elektrický systém na ovládanie aspoň jedného krídla vrát alebo dverí alebo podobného prvku, ktorého pohyb je zaisťovaný elektricky

Načítavanie...

Číslo patentu: E 396

Dátum: 02.06.2003

Autori: Tomasella Sergio, Cuzziol Fulvio, Sandrin Luigi, Marchetto Oscar

MPK: E05F 15/00, G05B 19/04

Značky: dveří, elektricky, aspoň, jedného, prvků, ovládanie, vrát, zaisťovaný, podobného, systém, pohyb, křídla

Text:

...komplexy alebo areály je naeurópskej úrovni upravená normou CEN prEN 13241.0008 Inštalované mechanizmy tohto typu sú elektricky pripojené na elektrický riadiaci systém. Presnejšie povedané sú tieto mechanizmy všeobecne pripojene priamo a miestne k periférnmn jednotkám elektrického riadiaceho systému, kde sú tieto jednotky pripojené priamo prostredníctvom elektrických vodičov na ústrednú riadiacu jednotku elektrického riadiaceho systému,...

Pyrimidínové deriváty ako modulátory receptora rastového faktora-1 podobného inzulínu (IGF-I)

Načítavanie...

Číslo patentu: E 5703

Dátum: 03.12.2002

Autori: Thomas Andrew, Pape Andrew, Barlaam Bernard

MPK: C07D 239/00, A61P 35/00, A61K 31/505...

Značky: rastového, modulátory, receptora, igf-i, podobného, pyrimidinové, faktora-1, inzulínu, deriváty

Text:

...ktorou sa môže liečiť rakovina. n vitro a in vivo štúdie, pri ktorých sa použili dominantne-negativne variácie IGF-1 R toto podporujú. Najmä bod, kde dochádza k mutácii v mieste viazania ATP, ktorý blokuje účinnosť receptorovej tyrozinkinázy, sa ukázal účinným v prevencii rastu nádorovej bunky (Kulik et al., Mol. Cell. Biol., 17, 1595-1606, 1997). Niektoré dôkazy naznačujú, že normálne bunky sú menej citlivé na apoptózu spôsobenú...

Zariadenie na ukladanie drôtu, lana alebo podobného predmetu

Načítavanie...

Číslo patentu: 279163

Dátum: 08.06.1994

Autor: Pach Karl

MPK: B60M 1/28

Značky: zariadenie, předmětů, drôtu, podobného, ukladanie

Zhrnutie / Anotácia:

Zariadenie na ukladanie drôtu, lana alebo podobného predmetu predstavuje koľajové vozidlo (1) s dvoma bubnami (2, 3) na drôt. Na ložnej ploche koľajového vozidla sú umiestnené dve ramená (4, 5). Ramená (4, 5) sú na ložnej ploche koľajového vozidla uložené každé na jednej točni (6). Na voľnom konci každého ramena je v ložisku (7) umiestnené ústrojenstvo (8) na výjazd, zavedenie, prípadne zadržanie drôtu (9). Na zdvíhanie a spustenie ramien (4,...

Spôsob výroby rohože alebo výrobku podobného tvaru z keramických, sklenených alebo minerálnych vlákien alebo z ich zmesi a zariadenie na uskutočnenie tohto spôsobu

Načítavanie...

Číslo patentu: 277732

Dátum: 11.06.1991

Autor: Nieminen Jorma

MPK: D04H 1/42, D04H 1/00, D04H 1/70...

Značky: výroby, tohto, spôsob, uskutočnenie, výrobků, tvaru, spôsobu, rohože, zmesí, keramických, podobného, sklenených, zariadenie, vlákien, minerálnych

Zhrnutie / Anotácia:

Vlákna sa privádzajú do styku s prúdom vzduchu, ktorý ich prenáša a ukladá do tvaru homogénneho vláknitého rúna v prvej dopravnej rovine, z ktorej sa premiestňujú do protiľahlej dopravnej roviny prúdom vzduchu prechádzajúcim prvou dopravnou rovinou, čím sa vlákna, náhodne orientované, usadzujú a vytvárajú vláknité rúno, ktoré sa podrobuje prípadne ďalšej úprave na spojenie vlákien. Zariadenie, obsahujúce ústrojenstvo na vrstvenie vlákien do...

Stroj s nožovým válcem ke zpracování usní, kožek a podobného materiálu

Načítavanie...

Číslo patentu: 261214

Dátum: 12.01.1989

Autori: Dorstewitz Rainer, Richter Gerhard

MPK: C14B 1/06

Značky: zpracování, kožek, stroj, podobného, materiálů, nožovým, usní, válcem

Text:

...je uložen v nosných pákách 29, łq, které jsou Výkyvné pomocí řetězu 31, 32 přídržnou pákou E, QA proti síle pružiny gâ, gg, tak aby držely odváděcí válec gg V předem stanovené vzdálenosti od nožového válce Ä. Snímač gg, pracující například induktivně, je uložen na vřeténkugg, které je přestavitelné pomocí šnekového mechanismu 39 motorkem 32 přes pevný hřídelil. vodíoí tyč 35 je uložena v ramenech 33, gg. Snímač gl je přestavován motorkem...

Způsob výroby vysoce aromatického produktu zušlechtění uhlí podobného smole

Načítavanie...

Číslo patentu: 238614

Dátum: 15.05.1987

Autori: Koch Karl Heinz, Omran Jafar

MPK: C10G 1/04

Značky: smole, způsob, podobného, výroby, aromatického, vysoce, zušlechtění, uhlí, produktů

Zhrnutie / Anotácia:

Vynález se týká způsobu výroby vysoce aromatického produktu zušlechtění uhlí, podobného smole, především rozemletého uhlí nebo podobné uhlíkaté sloučeniny do roztoku s aromatickými rozpouštědly za zvýšené teploty, jehož podstata spočívá v tom, že se 20 až 50 hmot. dílů této pevné látky převede do roztoku za použití 30 až 80 hmot. dílů směsi aromátů pocházejících z uhlí, se střední teplotou varu vyšší než 350 °C, během 1 až 3 hodin při teplotě v...

Zařízení pro ukládání malých dílů z textilního a podobného materiálu do hraničky

Načítavanie...

Číslo patentu: 229482

Dátum: 01.03.1986

Autor: Skořepa Václav

MPK: D05B 35/00

Značky: materiálů, podobného, malých, hraničky, ukládání, zařízení, dílů, textilního

Zhrnutie / Anotácia:

Zařízení pro ukládání malých dílů z textilního a podobného materiálu do hraničky je tvořeno propadlem dvířkového typu umístěným v rovině desky pracovního stolu stroje za místem zpracování, pod nímž je umístěn zásobník s pohyblivým dnem. Nad propadlem je umístěn svislý pneumatický válec, jehož pístnice je na svém volném konci opatřena dutou hubicí, která vniká do propadla vzápětí po jeho otevření, protlačuje do zásobníku ukládaný díl a po...

Způsob výroby vysocearomatického produktu zušlechtění uhlí podobného smole

Načítavanie...

Číslo patentu: 219920

Dátum: 15.09.1985

Autori: Franck Heinz-gerhard, Köhler Helmut, Stadelhofer Jürgen

Značky: způsob, smole, produktů, uhlí, podobného, vysocearomatického, zušlechtění, výroby

Zhrnutie / Anotácia:

Vynález spadá do oblasti zušlechťování uhlí. Způsob výroby vysocearomatického produktu zušlechtěním uhlí podle vynálezu spočívá v tom, že se uhlí nebo uhlíkaté suroviny dezintegrují aromatizovanými zbytky z parní pyrolýzy ropných frakcí v kombinaci se směsmi uhelných aromátů se střední teplotou varu mezi 350 až 600 °C jako doplňkovým rozpouštědlem. Přidávají se popřípadě další rozpouštědla. Reakce se provádí za zvýšené teploty a tlaku.

Tvářecí forma pro výrobu porcelánového a podobného zboží

Načítavanie...

Číslo patentu: 225916

Dátum: 01.07.1985

Autori: Vostrý Jiří, Klobouček Jiří, Růžička František

Značky: tvářecí, forma, zboží, výrobu, porcelánového, podobného

Zhrnutie / Anotácia:

Tvářecí forma pro výrobu porcelánového a podobného zboží, která je určena pro výrobu plochých výrobků, kupř. talířů, mís atd. s případným reliefem, vyráběných točením. Tvářecí forma je tvořena tenkostěnným výliskem z palstické hmoty na bázi poly-?-olefinu, např. polypropylenu, polyesteru, polyamidu nebo polyformaldehydu s případnou směsí skelných vláken. Tvářecí forma je opatřena středicím trnem a ve zlomu do praporu má alespoň jednu kruhovou...