Patenty so značkou «faktorov»

Produkcia rekombinantných faktorov krvnej zrážanlivosti v ľudských bunkových líniách

Načítavanie...

Číslo patentu: 287706

Dátum: 17.06.2011

Autori: Lehnerer Michael, Hörster Andrea, Schröder Carola, Hauser Charlotte

MPK: A61K 38/48, A61K 38/36, A61K 38/37...

Značky: produkcia, líniách, bunkových, rekombinantných, faktorov, zrážanlivosti, krvnej, ľudských

Zhrnutie / Anotácia:

Je opísaný spôsob produkcie rekombinantných ľudských faktorov krvnej zrážanlivosti, konkrétne faktora VIII a faktora IX, s využitím nesmrteľnej ľudskej bunkovej línie stabilne exprimujúcej vírusový transkripčný aktivačný proteín a nesúcej vektor, ktorý má promótor funkčne viazaný so sekvenciou DNA kódujúcou faktor krvnej zrážanlivosti za predpokladu, že uvedený promótor nie je vírusový promótor, ktorý je stimulovaný uvedenými vírusovými...

Spôsob stanovenia rizikových faktorov Alzheimerovej choroby

Načítavanie...

Číslo patentu: E 16776

Dátum: 11.08.2009

Autor: Roses Allen

MPK: C12Q 1/68

Značky: faktorov, stanovenia, rizikových, alzheimerovej, choroby, spôsob

Text:

...koronáme artériové ochorenie. Tiež je popísané, že skúmaným stavom je diabetes mellitus typu II. Tiež je popísané, že skúmaným stavom je Parkinsonova choroba. Vniektorých uskutočneniach je skúmaným stavom Alzheimerova choroba.0010 Vniektorých uskutočneniach je známym rizikovým faktorom polymorñzmu alela Apolipoproteínu E (napr. ApoE 2, ApoE 3, ApoE 4).0011 V niektorých uskutočneniach je skúmané genetické miesto vo väzbovej nerovnovàhe...

Mutanty rastových faktorov s vysokou aktivitou

Načítavanie...

Číslo patentu: E 11893

Dátum: 17.11.2006

Autori: Plöger Frank, Kruse Michael, Pohl Jens

MPK: A61P 19/00, A61P 19/10, A61K 38/18...

Značky: rastových, faktorov, aktivitou, mutanty, vysokou

Text:

...zvýšeného prežitia dopamínergných neurónov, ako je opísané napríklad v Kríeglstein a spol. 1995 (J. Neuroscienoe Res. 42, 724-732) alebo Sullivan a spol. 1997 (Neuroscience Letters 233, 73-76) c) vyrastanie nervových vlákien z embryonálnej sietnice, ako je opísané napríklad v W 097/03188d) angiogénny potenciál týchto proteínov, overený napríklad v in vivo modeli rohovkového mikrovaku(Comeal micropocket model), ako je opisaný napríklad v...

Spôsob a zariadenie pre nastavenie amplifikačných faktorov pre vyhradené fyzické kanály v mobilnom telekomunikačnom systéme

Načítavanie...

Číslo patentu: E 15180

Dátum: 06.02.2006

Autori: Kwak Yong-jun, Lee Ju-ho, Kim Young-bum, Heo Youn-hyoung

MPK: H04W 52/34, H04W 52/16

Značky: kanály, fyzické, nastavenie, spôsob, amplifikačných, faktorov, telekomunikačnom, systéme, mobilnom, zariadenie, vyhradené

Text:

...šumu v uzle B 100,aby bolo možné zvýšiť celkový výkon systému. Preto uzol B 100 prideľuje pomalý prenos vzdialenému UE 104 a rýchly prenos neďalekému UE 101.0016 OBR. 4 je schéma zobrazujúca typický tok signálu pre prenos správ na E-DCH.0017 S odkazom na OBR. 4, uzol B 200 a UE 201 vytvárajú E-DCH v kroku 202. Krok 202 zahŕňa prenos správ na vyhradených prenosových kanáloch. UE 201 odovzdáva informácie o svojom stave uzlu B 200 v kroku 204....

Vylepšené modulátory koagulačných faktorov

Načítavanie...

Číslo patentu: E 16820

Dátum: 22.04.2005

Autor: Rusconi Christopher

MPK: A61K 48/00, A61K 31/711, A61K 47/48...

Značky: koagulačných, vylepšené, modulátory, faktorov

Text:

...viac než 7 pacientov primajúcich infúziu a u viac než 14pacientov uživajúcich dávky vo forme piluliek. Terapeutický interval na dosiahnutie účinku. bez vystavenia pacienta riziku krvácania je malý, približne 1 až menej než 3 ug heparinu/na plazmy. Pri koncentrácii väčšej než 4 ug/ml heparínu, aktivita zrážania nie je zistiteľná. Teda, počas liečby je nutné, aby koncentrácie v plazme pacienta boli 2 terapeutického intervalu. 0007 Vynálezcovia...

Spôsob prípravy N-terminálom modifikovaných chemotaktických faktorov

Načítavanie...

Číslo patentu: E 3895

Dátum: 13.04.2004

Autori: Lenter Martin, Wandl Robert, Doods Henri, Seidler Randolph, Necina Roman

MPK: C07K 14/435, A61K 38/19, A61P 9/00...

Značky: faktorov, spôsob, n-terminálom, přípravy, chemotaktických, modifikovaných

Text:

...MCP-l proteínu izolovaného zprírodného zdroja je N-koniec blokovaný. Ako sa zístilo neskôr, toto naznačuje na posttranslačnú modiñkáciu, pri ktorej sa glutmnín, uvoľnený po odštiepenícagttcaatg atttgaatga cttcctggct atgctttcatccccatcctc tcacccccct cagatttaac ctćtccccct gagaccaacc aaagtctctg Ctcgctcagc gttatcatgg caagataagg gcagagcctg atccagctct gatcagggta cagaatctgg tgagtatcag gtggggctcc gacacttgta ttatataccc ctctgaggta ttttgttttt...

1-Oxa-3-aza-dibenzoazulény ako inhibítory tvorby tumor nekrotizujúcich faktorov a medziprodukty na ich prípravu

Načítavanie...

Číslo patentu: E 758

Dátum: 09.04.2003

Autori: Mercep Mladen, Mesic Milan, Pesic Dijana, Benko Iva

MPK: A61K 31/42, C07D 498/00

Značky: faktorov, tumor, přípravu, tvorby, 1-oxa-3-aza-dibenzoazulény, medziprodukty, inhibitory, nekrotizujúcich

Text:

...získané pri in vivo pokusoch na myšiach, V ktorých boli inaktivované myšie gény pre TNF-a alebo ich receptor. Takéto zvieratá sú rezistentné na kolagénom-indukovanú artritídu (Mori 1 et al.,J. lmmunol., 1996,157 3178-3182) a na šok spôsobený endotoxínom (Pfeffer K et al.,Cell, 1993, 73457-467). Pri pokusoch na zvieratách, kedy bolazvýšená hladina TNF-a, sa vyskytla chronická zápalová polyartritída(Georgopoulos S. et al., J.Inflamm., 1996,...

2-tiadibenzoazulény ako inhibítory tvorby tumor nekrotizujúcich faktorov a medziprodukty na ich prípravu

Načítavanie...

Číslo patentu: E 700

Dátum: 09.04.2003

Autori: Ozimec Ivana, Pesic Dijana, Mercep Mladen, Mesic Milan

MPK: C07D 495/00, A61K 31/38

Značky: inhibitory, tumor, nekrotizujúcich, 2-tiadibenzoazulény, přípravu, medziprodukty, faktorov, tvorby

Text:

...a voči šoku spôsobenému endotoxínom (Pfeffer K. et al., Cell, 1993, 73 457- 467). Pri experimentoch so zvieratami, kde bola zvýšená hladina TNF-a, sa vyskytla chronická zápalová polyartritída (Georgopoulos Set al., J. Inflamm., 1996, 46 86- 97 Keffer J et al., EMBO J., 1991, 10 4025-4031) a jej patologický obraz sa zmiernil inhibítormi tvorby TNF-d. Liečba takýchto zápalových a patologických stavov obvykle zahŕňa použitie...

Nové 1,2,3-substituované indolizinové deriváty, inhibítory faktorov FGF, spôsob ich prípravy a farmaceutické kompozície obsahujúce tieto deriváty

Načítavanie...

Číslo patentu: E 296

Dátum: 02.04.2003

Autori: Guillo Nathalie, Herbert Jean-marc, Badorc Alain, Bordes Marie-francoise, Bono Françoise

MPK: A61P 29/00, A61P 35/00, A61K 31/435...

Značky: farmaceutické, obsahujúce, kompozície, 1,2,3-substituované, indolizinové, tieto, inhibitory, spôsob, nové, faktorov, deriváty, přípravy

Text:

...atóm vodíka alebo alkylovú skupinu obsahujúcu 1 až 5 uhlíkových atómov, R 5 znamená alkylovú skupinu obsahujúcu 1 až 5 uhlikových atómov alebo skupinu ACO-Alk, Ph znamená fenýlovú skupinu prípadne substituovanú jedným alebo niekoľkými atómami halogénov, jednou alebo niekoľkými alkoxýskupinami obsahujúcimi 1 až 5 uhlíkových atómov, jednou alebo niekoľkými karboxylovými skupinami alebo jednou alebo niekoľkými alkoxykarbonýlovými skupinami...

Prístroj na prípravu koncentrátu koagulačných faktorov z krvnej vzorky

Načítavanie...

Číslo patentu: 279151

Dátum: 19.02.1992

Autori: Weis-fogh Ulla, Holm Niels Erik, Hern Soren

MPK: A61K 35/16

Značky: krvnej, vzorky, faktorov, prístroj, koagulačných, přípravu, koncentrátů

Zhrnutie / Anotácia:

Prístroj obsahuje prvú komoru (14) na zachytávanie krvnej vzorky a separáciu plazmovej frakcie a druhú komoru (15) na zachytávanie plazmovej frakcie cez spojovací kanálik (22) komôr (14, 15), jeho blokovací ventil (24) s ovládacou tyčou (25) a prvý prepravný prostriedok (30) s koncom (31) v druhej komore (15) na zrážanie koncentrátu koagulačných faktorov. Druhá komora (15) je napojená na vyberateľnú injekčnú striekačku (36) na odber uvedeného...

Zariadenie na zvýšenie intenzity mechanických faktorov opotrebovania skúšaných materiálov

Načítavanie...

Číslo patentu: 226625

Dátum: 15.02.1986

Autor: Tolnai Rudolf

Značky: skúšaných, zvýšenie, zariadenie, materiálov, intenzity, mechanických, opotrebovania, faktorov

Zhrnutie / Anotácia:

Zariadenie je určené na spevňovanie abrazívnych médií pri skúškach abrazívneho opotrebenia v laboratórnych podmienkach za účelom zvýšenia intenzity pôsobenia mechanických faktorov na skúšobné materiály pri opotrebení. Zariadenie pozostáva z utláčacej dosky určitej šírky a na nej vertikálne umiestnených držiakov, ktoré umožňujú nastavenie pracovnej polohy dosky a intenzitu utláčania média. Utláčacia doska má upravenú nábehovú časť s ohybom a...

Zariadenie na skúšanie opotrebenia materiálov s možnosťou modelovania faktorov opotrebenia

Načítavanie...

Číslo patentu: 225208

Dátum: 01.12.1984

Autori: Tolnai Rudolf, Poničan Juraj

Značky: možnosťou, faktorov, skúšanie, modelovania, opotrebenia, materiálov, zariadenie

Zhrnutie / Anotácia:

Zariadenie na skúšanie opotrebenia materiálov s možnosťou modelovania faktorov opotrebenia vyznačené tým, že pozostáva jednak z bubna /2/ uloženého rotačne v jednom smere a opatreného časťou /1/, umiestnenou v jeho horizontálnej osi pre uchytenie v skľučovadle sústruhu /12/, pričom po vnútornom obvode bubna /2/ je umiestnená vymeniteľná opotrebovávacia dráha /13/ s premenlivým polomerom, vymedzená plechmi /14/, v bubne /2/ je volne uložené...