C12N 15/19

Peptidová zlúčenina, spôsob jej výroby a použitie, farmaceutický prostriedok, polynukleotid, vektor a hostiteľská bunka

Načítavanie...

Číslo patentu: 287737

Dátum: 18.07.2011

Autori: Cheetham Janet, Liu Chuan-fa, Feige Ulrich

MPK: C07K 14/52, A61K 38/19, A61P 7/06...

Značky: farmaceutický, peptidová, zlúčenina, buňka, výroby, vektor, použitie, polynukleotid, spôsob, hostiteľská, prostriedok

Zhrnutie / Anotácia:

Je opísaná peptidová zlúčenina všeobecného vzorca TMP1-(L1)n-TMP2, kde TMP1 a TMP2 sú každý nezávisle vybratý zo súboru základných zlúčenín obsahujúcich štruktúru X2-X3-X4-X5-X6-X7-X8-X9-X10, kde X2 je vybratý z Glu, Lys a Val X3 je vybratý z Gly a Ala X4 je Pro X5 je vybratý z Tr a Ser X6 je vybratý z Leu, Ile, Val, Ala a Phe X7 je vybratý z Arg a Lys X8 je vybratý z Gln, Asn a Glu X9 je vybratý z Trp, Tyr, Cys, Ala a Phe X10 je vybratý z Leu,...

Použitie CC chemokínového mutanta, farmaceutický prostriedok s obsahom chemokínového mutanta, skrátený a mutovaný humánny RANTES a spôsob jeho výroby

Načítavanie...

Číslo patentu: 287523

Dátum: 13.12.2010

Autori: Wells Timothy, Kosco-vilbois Marie, Proudfoot Amanda

MPK: C07K 14/52, A61K 38/19, A61P 25/00...

Značky: humánny, mutovaný, farmaceutický, výroby, spôsob, skrátený, použitie, mutanta, rantes, obsahom, prostriedok, chemokínového

Zhrnutie / Anotácia:

Je opísané použitie CC chemokínového mutanta, ktorý obsahuje aspoň dve mutácie v katiónovom mieste 40's slučky a ktorý má v porovnaní so štandardným typom molekuly zníženú GAG-väzbovú aktivitu, na prípravu farmaceutického prostriedku na liečenie sklerózy multiplex a/alebo iných demyelinačných ochorení, pričom CC chemokín je vybraný zo skupiny obsahujúcej RANTES, MIP-1alfa, MIP-1beta, MIP-3, MIP-4, HCC1, I309, I35612 a MCP-2. Ďalej je opísaný...

Izolovaný alebo rekombinantný polynukleotid kódujúci antigénny polypeptid, expresný vektor, hostiteľská bunka, väzbová zložka, súprava a spôsob jeho použitia a expresie

Načítavanie...

Číslo patentu: 287198

Dátum: 25.02.2010

Autor: Bazan Fernando

MPK: C07K 16/18, C07K 14/435, C12N 15/19...

Značky: súprava, antigénny, polynukleotid, buňka, rekombinantný, expresie, expresný, izolovaný, väzbová, kódujúci, použitia, hostiteľská, zložka, polypeptid, spôsob, vektor

Zhrnutie / Anotácia:

Sú opísané prečistené gény kódujúce cytokíny u cicavcov, látky v tomto procese zahrnuté vrátane prečistených proteínov, špecifických protilátok a nukleových kyselín kódujúcich tieto molekuly. Ďalej je opísaný spôsob použitia týchto látok a diagnostická súprava.

RANTES skrátené na aminokonci, DNA molekuly, expresný vektor, hostiteľská bunka, rekombinantný spôsob jeho prípravy, farmaceutický prostriedok s jeho obsahom a jeho použitie

Načítavanie...

Číslo patentu: 286495

Dátum: 05.11.2008

Autori: Struyf Sofie, Proost Paul, Van Damme Jo

MPK: A61K 38/19, C07K 14/435, A61K 38/43...

Značky: vektor, expresný, molekuly, rekombinantný, hostiteľská, farmaceutický, spôsob, prostriedok, buňka, použitie, přípravy, obsahom, rantes, skrátené, aminokonci

Zhrnutie / Anotácia:

RANTES skrátené na aminokonci, ktorým chýbajú NH2-koncové aminokyseliny zodpovedajúce aminokyselinovým zvyškom 1 až 2 prirodzene sa vyskytujúcich RANTES, a majú chemokínový antagonistický účinok, ďalej sa vynález týka aj cDNA sekvencií, ktoré ich kódujú, ich použitia na liečbu a/alebo diagnostiku ochorení, pri ktorých je nutná antagonistická aktivita proti účinkom chemokínov a farmaceutický prostriedok s ich obsahom.

MCP-2 skrátený na aminokonci, DNA molekuly, expresný vektor, hostiteľská bunka, rekombinantný spôsob jeho prípravy, farmaceutický prostriedok s jeho obsahom a jeho použitie

Načítavanie...

Číslo patentu: 286439

Dátum: 18.09.2008

Autori: Struyf Sofie, Proost Paul, Van Damme Jo

MPK: C07K 14/435, A61K 38/43, A61K 38/19...

Značky: obsahom, přípravy, prostriedok, rekombinantný, molekuly, hostiteľská, expresný, vektor, použitie, buňka, farmaceutický, skrátený, mcp-2, spôsob, aminokonci

Zhrnutie / Anotácia:

Je opísaný monocytový chemotaktický proteín MCP-2, skrátený na aminokonci, ktorému chýbajú NH2-koncové aminokyseliny zodpovedajúce aminokyselinovým zvyškom 1 až 5 prirodzene sa vyskytujúcich MCP-2 a ktorý má chemokínový antagonistický účinok. Ďalej vynález poskytuje cDNA sekvencie, ktoré ich kódujú, ich použitie na liečbu a/alebo diagnostiku ochorení, pri ktorých je nutná antagonistická aktivita proti účinkom chemokínov, a farmaceutické...

Vektor na výrobu IL-4 a muteínov IL-4 v kmeni Escherichia coli, vektor obsahujúci DNA sekvenciu, Escherichia coli transformovaná jedným alebo viacerými vektormi a použitie vektora

Načítavanie...

Číslo patentu: 285603

Dátum: 22.03.2007

Autori: Apeler Heiner, Wehlmann Hermann

MPK: C12N 15/09, C07K 14/435, C12N 1/21...

Značky: vektormi, vektor, použitie, transformovaná, coli, escherichia, výrobu, jedným, sekvenciu, vektora, muteínov, viacerými, kmeni, obsahujúci

Zhrnutie / Anotácia:

Vektor na výrobu IL-4 a muteínov IL-4 v kemni Escherichia coli, pozostávajúci z operatívne spojených elementov v smere 5' k 3': regulovateľný promótor pozostávajúci z promótora fágu T5 Escherichia coli a dvoch lac operátorových sekvencií, väzbového miesta pre ribozóm z bakteriofágu T7g10 E.coli, iniciačného translačného kodónu, štruktúrneho génu pre IL-4 alebo muteín IL-4 a transkripčného terminátora za štruktúrnym génom. Do rozsahu riešenia...

Bunky zacieľujúce nádor, upravené na produkciu ligandu indukujúceho apoptózu, súvisiaceho s faktorom nádorovej nekrózy (TRAIL)

Načítavanie...

Číslo patentu: E 7115

Dátum: 21.07.2005

Autori: Carlo-stella Carmelo, Gianni Alessandro, Colotta Francesco

MPK: C12N 5/16, C12N 15/19, C07K 14/435...

Značky: produkciu, indukujúceho, zacieľujúce, nekrózy, súvisiaceho, nádorovej, nádor, faktorom, upravené, apoptózu, trail, ligandu, buňky

Text:

...použitia plazmidov a virusových vektorov s vhodnými regulačnými genetickými prvkami, ako sú tkanivovo-špecifické promótory alalebo enhancery.0021 Optimálnu transdukčnú účinnost buniek CD 34 možno získat vystavením gradačnému (50 do 500) mnohonásobku infekcie (MOI) Ad-TRAIL (50 do 500) za bezsérových podmienkach pri 37 °C. Potom sa pridá sérum doplňujúce médium (RPMI-1640/FBS 20 ) a po niekoľkých hodinách sú kultúry doplnené Gene Boosterom...

Spôsob prípravy N-terminálom modifikovaných chemotaktických faktorov

Načítavanie...

Číslo patentu: E 3895

Dátum: 13.04.2004

Autori: Lenter Martin, Seidler Randolph, Wandl Robert, Necina Roman, Doods Henri

MPK: A61P 9/00, A61K 38/19, C07K 14/435...

Značky: chemotaktických, spôsob, faktorov, n-terminálom, modifikovaných, přípravy

Text:

...MCP-l proteínu izolovaného zprírodného zdroja je N-koniec blokovaný. Ako sa zístilo neskôr, toto naznačuje na posttranslačnú modiñkáciu, pri ktorej sa glutmnín, uvoľnený po odštiepenícagttcaatg atttgaatga cttcctggct atgctttcatccccatcctc tcacccccct cagatttaac ctćtccccct gagaccaacc aaagtctctg Ctcgctcagc gttatcatgg caagataagg gcagagcctg atccagctct gatcagggta cagaatctgg tgagtatcag gtggggctcc gacacttgta ttatataccc ctctgaggta ttttgttttt...

Fúzny proteín, spôsob jeho výroby, použitie a farmaceutické kompozície na jeho báze

Načítavanie...

Číslo patentu: 283494

Dátum: 21.07.2003

Autori: Hofmann Uwe, Stadlmüller Jörg, Matzku Siegfried, Strittmatter Wolfgang, Jäggle Carlota-silvia, Von Hoegen Ilka

MPK: C12N 15/72, C12N 15/64, C12N 15/19...

Značky: výroby, použitie, proteín, báze, spôsob, fúzny, farmaceutické, kompozície

Zhrnutie / Anotácia:

Fúzny proteín obsahujúci monoklonálnu protilátku alebo jej fragment zameranú na nádorovú bunku nesúcu epitop antigénu receptora epidermálneho rastového faktora (EGFR) a biologicky aktívny cytokín, ktorý je fúzovaný k protilátke alebo jej fragmentu a má cytotoxickú kapacitu na lýzu špecificky nádorových buniek, kde cytokínom je TNFalfa a protilátka pozostáva aspoň z variabilnej oblasti ťažkého reťazca protilátky, CH1, CH2 a CH3 domén konštantnej...

Antagonisty CXCR3-viažucich CXC chemokínov

Načítavanie...

Číslo patentu: E 1984

Dátum: 03.06.2003

Autori: Proudfoot Amanda, Kosco-vilbois Marie

MPK: A61K 38/19, C07K 14/435, C07K 19/00...

Značky: cxcr3-viažucich, antagonisty, chemokínov

Text:

...vkaždom chemokíne alebo vkaždej skupine vysoko homologických chemokínov sú takéto motívy Štruktúrované rozdielnym spôsobom. Niektoré ztýchto GAG-viažucich miest boli asociované so špecifickými konsenzus motívmi, ako napríklad BBXB (kde B znamená bázický zvyšok aX akýkoľvek iný zvyšok), alebo V iných usporiadaniach (Kuschert G a ďalší, 1999 Proudfoot A a ďalší, 2001).Hlavným dôsledkom tejto interakcie je agregovanie chemokínov, čo je...

Nový ligand cytokínu ZCYTOR17

Načítavanie...

Číslo patentu: E 11474

Dátum: 21.01.2003

Autori: Dasovich Maria, Kuestner Rolf, Dillon Stacey, Sprecher Cindy, Grant Francis, Kuijper Joseph, Hammond Angela, Gross Jane

MPK: A61K 39/395, A61K 38/19, C07K 14/52...

Značky: ligand, nový, cytokínu, zcytor17

Text:

...buniek bez aktivácie.0009 DATABASE EMBL identifikačné č. ACO 48338 (16. apríla 2000) opisuje 12 BAC RP 211-512 M 8 od Homo sapiens. DATABASE EMBL identifikačné č. AKO 05939 (8. februára 2001) opisuje cDNA. Musmusculus dospelých samčích semenníkov, rozšírená knižnica RIKEN s plnými dĺžkami, klonl 700013 B 14 produkt hypotetický proteín,úplná sekvencia inzertu.0010 Demonštrované in vivo aktivity rodiny cytokínov ilustrujú enormný klinický...

Protilátky ANTI-IGF-IR a ich použitie

Načítavanie...

Číslo patentu: E 2025

Dátum: 20.01.2003

Autori: Corvaia Nathalie, Leger Olivier, Goetsch Liliane

MPK: A01K 67/027, A61P 17/00, A61K 39/395...

Značky: použitie, protilátky, anti-igf-ir

Text:

...l 25 l 66-173, 1999).0004 Funkcia IGF systému v kancerogenéze sa stala počas posledných desiatich rokov predmetom intenzívneho výskumu. Tento záujem nasledoval po zistení faktu, že okrem mitogénnych a anti~apoptotických vlastností sa IGF-IR zdá byť nutný na ustanoveniea udržanie transformovaného fenotypu. Bolo zistené, že zvýšená expresia alebo konštitutívna aktivácia IGF-IR vedie V množstve bunkových typov k rastu buniek nezávislému na...

Spôsob čistenia proteínov exprimovaných v baktériách

Načítavanie...

Číslo patentu: E 517

Dátum: 15.01.2003

Autori: Capponi Luciano, Rossi Mara

MPK: C07K 14/435, C12N 15/19

Značky: baktériách, čistenia, exprimovaných, spôsob, proteínov

Text:

...z hostiteľských buniek- Solubilizácia agregovaných chemokínovýeh proteínov v kroku inklúzne telieskal denaturáciaPríprava bunkových lyzátov z hostiteľských buniekChemokín získaný expresiou v prokaryotických bunkách musí najprv byť extrahovaný z hostiteľských buniek, V ktorých prebehla jeho expresia. Na lýzovanie buniek sú dostupne rôzne metódy. Ktoré z týchto metód treba použiť v konkrétnom prípade závisí od typu hostiteľských buniek a od...

Polypeptid mpl ligandu, jeho zodpovedajúca nukleová kyselina, expresný vektor a hostiteľská bunka, ktorá ho obsahuje, spôsob prípravy polypeptidu a jeho použitie

Načítavanie...

Číslo patentu: 282265

Dátum: 02.11.2001

Autori: De Savuage Frederic, Eaton Dan

MPK: A61K 38/19, C07K 14/52, C07K 16/24...

Značky: obsahuje, spôsob, kyselina, ktorá, přípravy, zodpovedajúca, buňka, hostiteľská, vektor, expresný, polypeptidů, použitie, nukleová, ligandu, polypeptid

Zhrnutie / Anotácia:

Je opísaný polypeptid mpl ligandu pripravený spôsobom, ktorý zahŕňa: (i) skríning humánnej genómovej knižnice s oligonukleotidom založeným na genómovej sekvencii znázornenej na obrázku 9 na izolovanie genómovej DNA, ktorá zahŕňa exón mpl ligandu kódujúci sekvenciu znázornenú na obrázku 9, spolu so zostávajúcimi exónmi génu, (ii) inzerciu DNA do expresného vektora, (iii) transfekciu cicavčej bunky génovým expresným vektorom a (iv) izoláciu...

Monoklonálna a humanizovaná monoklonálna protilátka proti interleukínu-5 alebo ich fragment, hybridóm, polypeptid, izolovaná DNA, rekombinantný vektor, hostiteľské bunky, spôsob prípravy polypeptidu afarmaceutický prostriedok

Načítavanie...

Číslo patentu: 280610

Dátum: 08.02.1995

Autori: Windsor William, Abrams John, Jenh Chung-her, Zavodny Paul, Silver Jon, Tindall Stephen, Petro Mary, Murgolo Nicholas, Chou Chuan-chu

MPK: A61K 39/395, C07K 16/24, C12N 15/19...

Značky: spôsob, vektor, izolovaná, interleukínu-5, humanizovaná, rekombinantný, prostriedok, buňky, přípravy, hybridom, hostiteľské, polypeptid, fragment, polypeptidů, proti, monoklonálna, protilátka, afarmaceutický

Zhrnutie / Anotácia:

Je opísaná monoklonálna protilátka, ktorá sa špecificky viaže na ľudský interleukín-5, hybridóm, ktorý produkuje uvedenú monoklonálnu protilátku komplementárne DNA, ktoré kódujú ťažký a ľahký reťazec variabilných oblasti tejto monoklonálnej protilátky a tiež ich CDR oblasti, ďalej sú uvedené humanizované monoklonálne protilátky a farmaceutické prostriedky zahŕňajúce monoklonálnu protilátku alebo anti-idiotypické protilátky, väzbové fragmenty,...