A61K 38/19

Látková kompozícia viažuca polypeptid TALL-1, kódujúca DNA, expresný vektor a hostiteľská bunka


Číslo patentu: 288175

Dátum: 12.03.2014

Autori: Hosung Min, Hailing Hsu, Xiong Fei

MPK: A61K 38/10, A61K 38/07, A61K 38/08...

Značky: tall-1, viažuca, vektor, kompozícia, kódujúca, polypeptid, buňka, expresný, hostiteľská, látková

Zhrnutie / Anotácia:

Látková kompozícia zahŕňajúca aminokyselinovú sekvenciu Dz2Lz4, kde z2 je aminokyselinový zvyšok a z4 je T alebo I a viažuca polypeptid TALL-1, pričom táto kompozícia nezahŕňa fragment TACI, BCMA, alebo BAFFR. DNA kódujúca túto látkovú kompozíciu, expresný vektor zahŕňajúci túto DNA a hostiteľská bunka zahŕňajúca tento expresný vektor. Kompozícia definovaná vyššie na použitie na liečenie autoimunitných ochorení sprostredkovaných B bunkami,...

Kompozícia obsahujúca glykozylovaný interferón beta-1a, farmaceutická kompozícia, použitie kompozície, in-vitro spôsob predĺženia účinnosti interferónu beta-1a a použitie polymérovej časti


Číslo patentu: 287918

Dátum: 27.02.2012

Autori: Whitty Adrian, Runkel Laura, Brickelmaier Margot, Pepinsky Blake, Hochman Paula

MPK: A61K 39/395, A61K 38/21, A61K 38/19...

Značky: glykozylovaný, predĺženia, obsahujúca, farmaceutická, interferonu, účinnosti, kompozície, in-vitro, interferon, použitie, spôsob, částí, beta-1a, polymérovej, kompozícia

Zhrnutie / Anotácia:

Je opísaná kompozícia interferónu-ß-1a obsahujúca glykozylovaný interferón-ß-1a spojený s polymérom nevyskytujúcim sa v prírode na N-konci interferónu-ß-1a, pričom polymér obsahuje polyalkylénglykolovú časť, použitie kompozície na liečenie nádorov rakoviny, autoimunitných stavov, vírusových ochorení alebo angiogénnych ochorení, in-vitro spôsob predĺženia účinnosti interferónu-ß-1a v in-vitro systéme.

Formulácia pre bovinný faktor stimulujúci granulocytárne kolónie a jeho varianty


Číslo patentu: E 18995

Dátum: 22.09.2011

Autori: Davagnino Juan, Kha Catherine Ngan, Klotz Alan Voskamp

MPK: C07K 14/535, A61K 38/19, A61P 29/00...

Značky: formulácia, kolónie, faktor, stimulujúci, varianty, granulocytárne, bovinný


...vodné formulácie, ktoré obsahujú polypeptid bG-CSF alebo jeho variant, pufrovacie látky a pomocnú látku, kde uvedená formulácia je v podstate bez polyoxyetylén(20)sorbitan-monolaurátu.Vynález tiež poskytuje spôsoby použitia, lyotilizované alebo práškové formy0010 Tieto stabilné vodné formulácie bovinného faktora stimulujúceho kolónie granulocytov (bG-CSF) obsahujú polypeptid bG-CSF alebo jeho variant. Ako sa v tomto texte používa, bovinný...

Peptidová zlúčenina, spôsob jej výroby a použitie, farmaceutický prostriedok, polynukleotid, vektor a hostiteľská bunka


Číslo patentu: 287737

Dátum: 18.07.2011

Autori: Liu Chuan-fa, Feige Ulrich, Cheetham Janet

MPK: A61P 7/06, A61K 38/19, C07K 14/52...

Značky: peptidová, farmaceutický, spôsob, zlúčenina, prostriedok, vektor, polynukleotid, použitie, buňka, výroby, hostiteľská

Zhrnutie / Anotácia:

Je opísaná peptidová zlúčenina všeobecného vzorca TMP1-(L1)n-TMP2, kde TMP1 a TMP2 sú každý nezávisle vybratý zo súboru základných zlúčenín obsahujúcich štruktúru X2-X3-X4-X5-X6-X7-X8-X9-X10, kde X2 je vybratý z Glu, Lys a Val X3 je vybratý z Gly a Ala X4 je Pro X5 je vybratý z Tr a Ser X6 je vybratý z Leu, Ile, Val, Ala a Phe X7 je vybratý z Arg a Lys X8 je vybratý z Gln, Asn a Glu X9 je vybratý z Trp, Tyr, Cys, Ala a Phe X10 je vybratý z Leu,...

Modifikované cytokíny na použitie pri terapii rakoviny


Číslo patentu: 287550

Dátum: 30.12.2010

Autor: Corti Angelo

MPK: A61K 38/19, A61K 38/21, A61K 31/70...

Značky: rakoviny, použitie, terapii, cytokíny, modifikované

Zhrnutie / Anotácia:

Sú opísané cytokínové deriváty, ktoré sú tvorené cytokínom a ligandom CD13 receptora. Sú schopné cielene sa viazať na nádorové bunky ciev. Je opísané aj ich použitie ako protinádorových činidiel.

Použitie CC chemokínového mutanta, farmaceutický prostriedok s obsahom chemokínového mutanta, skrátený a mutovaný humánny RANTES a spôsob jeho výroby


Číslo patentu: 287523

Dátum: 13.12.2010

Autori: Proudfoot Amanda, Wells Timothy, Kosco-vilbois Marie

MPK: A61K 38/19, A61P 25/00, C07K 14/52...

Značky: mutanta, prostriedok, farmaceutický, skrátený, chemokínového, mutovaný, obsahom, rantes, výroby, humánny, spôsob, použitie

Zhrnutie / Anotácia:

Je opísané použitie CC chemokínového mutanta, ktorý obsahuje aspoň dve mutácie v katiónovom mieste 40's slučky a ktorý má v porovnaní so štandardným typom molekuly zníženú GAG-väzbovú aktivitu, na prípravu farmaceutického prostriedku na liečenie sklerózy multiplex a/alebo iných demyelinačných ochorení, pričom CC chemokín je vybraný zo skupiny obsahujúcej RANTES, MIP-1alfa, MIP-1beta, MIP-3, MIP-4, HCC1, I309, I35612 a MCP-2. Ďalej je opísaný...

Konjugáty na liečbu mezoteliómu


Číslo patentu: E 12438

Dátum: 12.05.2009

Autori: Bordignon Claudio, Lambiase Antonio

MPK: A61P 35/00, A61K 38/19, A61K 47/48...

Značky: mezoteliómu, konjugáty, liečbu


...rizikom trombózy.0011 Valatanib (PTK 787), inhlbítor receptora VEGF a PDGF tyrozínkinázy, vykazoval medián prežívania bez progresie 4 mesiace pri podávaní chemonaivným pacientom ako terapia prvej línie. Stupňa toxicity 3/4 (stupeň 3 závažné vedľajšie účinky, stupeň 4 ohrozenie života alebo postihnutia) viedli k gastrointestinálnemu kNácaniu. neutropénii, lymfopénii, nevoínosti/zvracaniu,zvýšeným ALT/AST, hypertenziou (Jahan et al., J....

Zmes LT-alfa/beta heteromérneho komplexu a/alebo najmenej jedného LT-beta-R aktivujúceho činidla, farmaceutický prostriedok, LT-beta-R aktivujúce činidlo a spôsob jeho výberu


Číslo patentu: 286497

Dátum: 05.11.2008

Autori: Meier Werner, Benjamin Christopher, Browning Jeffrey

MPK: A61K 38/19, A61K 38/21, A61K 39/395...

Značky: aktivujúceho, heteromérneho, prostriedok, farmaceutický, činidlo, jedného, aktivujúce, najmenej, lt-beta-r, činidla, komplexu, spôsob, výběru

Zhrnutie / Anotácia:

Je opísaná farmaceutická kompozícia obsahujúca aspoň jedno LT-beta-R aktivujúce činidlo, pričom jedno LT-beta-R činidlo zahrnuje protilátku anti-LT-beta-R, a jej použitie na liečenie alebo zmiernenie postupu, závažnosti alebo účinkov neoplázie. Ďalej je opísané použitie LT-alfa/beta heteromérneho komplexu na prípravu farmaceutickej kompozície na podanie v prítomnosti aspoň jedného LT-beta-R aktivujúceho činidla na liečenie alebo zmiernenie...

RANTES skrátené na aminokonci, DNA molekuly, expresný vektor, hostiteľská bunka, rekombinantný spôsob jeho prípravy, farmaceutický prostriedok s jeho obsahom a jeho použitie


Číslo patentu: 286495

Dátum: 05.11.2008

Autori: Proost Paul, Struyf Sofie, Van Damme Jo

MPK: C07K 14/435, A61K 38/43, A61K 38/19...

Značky: buňka, skrátené, obsahom, použitie, molekuly, farmaceutický, spôsob, hostiteľská, vektor, aminokonci, rekombinantný, expresný, přípravy, rantes, prostriedok

Zhrnutie / Anotácia:

RANTES skrátené na aminokonci, ktorým chýbajú NH2-koncové aminokyseliny zodpovedajúce aminokyselinovým zvyškom 1 až 2 prirodzene sa vyskytujúcich RANTES, a majú chemokínový antagonistický účinok, ďalej sa vynález týka aj cDNA sekvencií, ktoré ich kódujú, ich použitia na liečbu a/alebo diagnostiku ochorení, pri ktorých je nutná antagonistická aktivita proti účinkom chemokínov a farmaceutický prostriedok s ich obsahom.

MCP-2 skrátený na aminokonci, DNA molekuly, expresný vektor, hostiteľská bunka, rekombinantný spôsob jeho prípravy, farmaceutický prostriedok s jeho obsahom a jeho použitie


Číslo patentu: 286439

Dátum: 18.09.2008

Autori: Proost Paul, Van Damme Jo, Struyf Sofie

MPK: C07K 14/435, A61K 38/19, A61K 38/43...

Značky: hostiteľská, obsahom, skrátený, přípravy, prostriedok, aminokonci, farmaceutický, použitie, vektor, rekombinantný, spôsob, expresný, molekuly, mcp-2, buňka

Zhrnutie / Anotácia:

Je opísaný monocytový chemotaktický proteín MCP-2, skrátený na aminokonci, ktorému chýbajú NH2-koncové aminokyseliny zodpovedajúce aminokyselinovým zvyškom 1 až 5 prirodzene sa vyskytujúcich MCP-2 a ktorý má chemokínový antagonistický účinok. Ďalej vynález poskytuje cDNA sekvencie, ktoré ich kódujú, ich použitie na liečbu a/alebo diagnostiku ochorení, pri ktorých je nutná antagonistická aktivita proti účinkom chemokínov, a farmaceutické...

Kvapalná formulácia G-CSF


Číslo patentu: E 17753

Dátum: 27.08.2008

Autori: Lubenau Heinz, Hinderer Walter

MPK: A61K 38/19, A61K 47/26, A61K 47/12...

Značky: kvapalná, formulácia, g-csf


...Táto úloha je riešená formami uskutočnenia, charakterizovanýrni V patentových nárokoch a ďalej osvetlenými. Predložený vynález sa najmä týka liečiva na použitie v liečbe rakoviny, ťažkej chronickej neutropénie (SCN), infekcie HIV, poškodenia centrálneho nervového systému alebo vedľajších účinkov na základe cytotoxickej terapie, zahmujúceho kvapalnú vodnú formuláciu G-CSF, pozostávajúeu v podstate z G-CSF a cukrového alkoholu,polysorbátu 80...

Kombinácia blys inhibície a mykofenolát mofetilu na liečenie autoimunitného ochorenia


Číslo patentu: E 14687

Dátum: 27.03.2008

Autori: Van Ness Kirk, Graffner Hans Otto Lennart, Wallis Wayne, Pena Rossi Claudia, Littau Alisa, Ponce Rafael, Holdren Matthew, Zuckerman Linda

MPK: A61K 38/19, A61K 45/06, A61K 31/365...

Značky: ochorenia, liečenie, autoimunitného, mykofenolát, inhibície, mofetilu, kombinácia


...0,05) za použitia Iog-transformovaných dát,okrem porovnania vehikulum vs. len MMF.0025 Obrázok 2 znázorňuje graf priemerných hodnôt (zl štandardná odchýlka) IgM pre štyri terapeutické skupiny vehikulum, len MMF, len atacicept a atacicept a MMF. Všetky párové porovnania týchto hodnôt boli štatisticky signitikantné (p 0,05) za použitia Iog-transformovaných dát,okrem porovnania vehikulum vs. len MMF.0026 Obrázok 3 znázorňuje graf priemerných...

Medziprodukty prípravy bivalentných mimetík Smac


Číslo patentu: E 18123

Dátum: 04.05.2007

Autori: Wang Shaomeng, Nikolovska-coleska Zaneta, Peng Yuefeng, Sun Haiying, Cai Qian, Qin Dongguang, Qiu Su

MPK: A61K 31/395, A61K 31/407, A61K 31/4192...

Značky: bivalentných, mimetík, přípravy, medziprodukty


...IA potentne potláčajúapoptózu indukovanú veľkým množstvom apoptotických stimulov,vrátane chemoterapeutických činidiel, ožarovania a imunoterapie0006 IA (XIAP) je najviac potentný inhibitor na potláčanie apoptózy u všetkých členov IAP Holcik a kol., Apoptosis 6253(2001) Lacasse a kol., Oncogene 173247 (1998) Takahashi a kol., J. Biol. Chem. 2737787 (1998) Deveraux a kol., Nature 3883 OO (1997) Sun a kol., Nature 4018 l 8 (1999) Deveraux a...

Dlhodobo pôsobiace polypeptidy a spôsoby ich produkcie a podávania


Číslo patentu: E 17157

Dátum: 05.02.2007

Autori: Fares Fuad, Fima Udi Eyal

MPK: A61K 31/00, A61K 38/00, A61K 38/19...

Značky: pôsobiace, dlhodobo, produkcie, polypeptidy, spôsoby, podávania


...poskytuje polynukleotid kódujúci polypeptid podľa tohto vynálezu. Vrôznych uskutočneniach môže byť sekvencia polynukletidu zvolená zo sekvencií uvedených v SEQ ID NO 44-46. Polynukleotid môže kódovať polypeptid, ktorý obsahujesignálny peptid, napríklad majúci aminokyselinovú sekvenciu uvedenú v SEQ ID NO 19.0013 Vynález taktiež poskytuje expresný Vektor obsahujúci polynukleotíd podľa tohto vynálezu, ako aj bunku obsahujúcu tento expresný...

Zlúčeniny príbuzné TDF a ich analógy


Číslo patentu: E 19177

Dátum: 20.09.2006

Autori: Carlson William, Bosukonda Dattatreymurty, Keck Peter, Bey Philippe

MPK: A61K 38/19, A61L 27/22, A61K 48/00...

Značky: analogy, príbuzné, zlúčeniny


...funkcie receptorov podobných TDF spolu so spôsobmi detekcie, prevencie a liečenia chorôb spojených s TDF.WO 03106972 opisuje analógy tkanivovćho diferenciačného faktora (TDF). Konkrétnejšie sú opísané štruktúme založené spôsoby a kompozície použiteľné pri návrhu,identiñkovaní a produkcii molekúl pôsobiacich ako modulátory funkcie receptorov podobnýchTDF spolu so spôsobmi detekcie, prevencie a liečenia chorôb spojených s TDF. SÚHRN...

Použitie TPO peptidových zlúčenín a farmaceutických kompozícií na liečenie anémie


Číslo patentu: E 17163

Dátum: 14.02.2006

Autori: Yurkow Edward, Macdonald Brian, Weis Jeffery

MPK: A61P 7/06, A61K 38/19

Značky: kompozícií, farmaceutických, zlúčenín, použitie, peptidových, anémie, liečenie


...kmeňové bunky produkujú ďalšie kmeňové bunky pre udržanie poolu týchto buniek. Preto sú pluripotentné kmeňové bunky okrem udržiavania svojho vlastného druhu schopné diferencovať sa do niekoľkých sublínií progenitorových buniek sobrnedzenejšou schopnosťou samoobnovy alebo bez schopnosti samoobnovy. Tieto progenitorové bunky vkonečnom dôsledku vedú k morfologicky rozoznateľným prekurzorovým bunkám. Progenitorové bunky sú schopné...

Použitie terapeuticky účinného množstva konvenčného humánneho leukocytového interferónu na výrobu lieku


Číslo patentu: 284712

Dátum: 31.08.2005

Autori: Blatt Lawrence, Taylor Milton

MPK: A61K 38/19, A61K 38/21, A61P 31/12...

Značky: použitie, lieku, humánneho, leukocytového, interferonu, množstva, výrobu, účinného, konvenčného, terapeuticky

Zhrnutie / Anotácia:

Je opísané použitie terapeuticky účinného množstva konvenčného humánneho leukocytového interferónu na výrobu liečiva na liečenie pacienta, ktorý je postihnutý stavom, ktorý je možné liečiť interferónom, pri ktorom je redukovaný alebo eliminovaný aspoň jeden vedľajší účinok všeobecne spájaný s podávaním alfa-interferónu, pričom stavom je hepatitída A, hepatitída B, hepatitída C alebo hepatitída delta.

Farmaceutický prostriedok obsahujúci aspoň jeden imunomodulačne pôsobiaci peptid, proteín alebo proteínový fragment


Číslo patentu: 284582

Dátum: 09.06.2005

Autori: Birnstiel Max, Buschle Michael, Schweighoffer Tamás, Steinlein Peter, Schmidt Walter

MPK: A61K 38/02, A61K 38/19, A61K 39/39...

Značky: fragment, farmaceutický, peptid, proteinový, prostriedok, obsahujúci, pôsobiaci, proteín, imunomodulačné, aspoň

Zhrnutie / Anotácia:

Farmaceutický prostriedok obsahuje aspoň jeden imunomodulačne pôsobiaci peptid, prípadne proteín (proteínový fragment) spolu s jedným adjuvans, pričom peptid je odvodený z patogénu alebo z nádorového antigénu. Adjuvans má schopnosť zvyšovať väzbu peptidu na bunky liečeného jedinca, prípadne vstup peptidu do buniek, a vyvolať posilnenie imunomodulačného pôsobenia peptidu. Výhodnými adjuvans sú bázické polyaminokyseliny, ako je polyarginín alebo...

Spôsob a systém na odstraňovanie rozpustného TNFR1, TNFR2 a IL2R pri pacientoch


Číslo patentu: E 12900

Dátum: 29.04.2005

Autor: Lentz Rigdon M

MPK: A61K 38/20, A61K 39/395, A61K 38/19...

Značky: systém, spôsob, rozpustného, tnfr1, pacientoch, tnfr2, odstraňovanie


...receptora faktora nekrózy nádorov l (sTNFRl), rozpustnému receptoru faktora nekrózy nádorov 2 (STNFRZ) a rozpustnému receptora interleukinu 2 (sIL 2 R), imobilizované naBol vyvinutý spôsob a systém na navodenie remisie ochorení vyznačujúcich sa nadmernou tvorbou sTNR a R interleukinu 2. Súčasťou tohto systému sú prostriedky na separáciu krvi na krvnú plazmu a krvinky, ako je zariadenie na plazmaferézu, pričom plazma sa potom spracováva pri...

Látka inhibujúca MIC-1


Číslo patentu: E 17414

Dátum: 13.04.2005

Autori: Breit Samuel Norbert, Bauskin Asne Rhoda

MPK: G01N 33/53, A61P 3/04, A61K 38/19...

Značky: látka, mic-1, inhibujúca


...stlpcami a prázdne stĺpce predstavujú myši s kontrolnými nádormi. Štatistické porovnanie bolo uskutočnené pomocou t-testu a počet hviezdičiek znázorňuje rastúcu štatistickú významnost od p 0.003 až do p 0.0001. Došlo k výraznému poklesu hmotnosti telesného tuku v inguinálnej. epididymálnej a retroperitoneálnej oblasti. Medzi týmito dvomi skupinami myší nebol zistený žiadny významný rozdiel v svalovej hmotnosti. NS nevýznamné p 0.01 p ...

Liečenie a diagnostikovanie neoplaziem použitím týmusového strómového lymfopoetínu


Číslo patentu: E 4589

Dátum: 16.07.2004

Autor: Oft Martin

MPK: G01N 33/574, A61K 38/19, A61P 35/00...

Značky: týmusového, lymfopoetínu, liečenie, neoplaziem, použitím, strómového, diagnostikovanie


...možu sa metastázy vytvárať v rôznych miestach tela. pričom Iymfatické uzíiny, pľúca. pečeň, mozog a kostná dreň sú najobvyklejšími miestami.0021 Pojem mutein, alebo nové mutantné proteiny, zahŕňa fragmenty, deriváty aanalógy polypeptídov. Technológia rekombinantnej DNA (genetické inžinierstvo) známa odbomíkom v danej oblasti techniky, sa može používat na vytvorenie nových mutantných proteínov alebo mutelnov,vrátane substitúcií...

Použitie multimerizovanej formy ligandov z rodiny TNF na prípravu liečiva na liečbu nádorov


Číslo patentu: E 2674

Dátum: 25.05.2004

Autor: Rosat Jean-pierre

MPK: A61P 35/00, A61K 38/19, A61K 47/48...

Značky: rodiny, ligandov, formy, multimerizovanej, přípravu, nádorov, liečivá, použitie, liečbu


...tumor nekrotizujúceho faktora 1 OX-40 L,gp 34,TNFSF 5 nadrodina tumor nekrotizujúceho faktoraŤCD 4 OLG,IMD 3, (ligand), člen 5 (hyper-IgM syndróm) HIGM 1,CD 4 OL,hCD 4 OL, TRAP,CD 154, gp 39TNFSF 6 nadrodina tumor nekrotizujúceho faktora FasL, APT 1 LG 17 FŤNFSF 7 nadrodina tumor nekrotizujúceho faktora 1 CD 70,CD 27 L,(ligand) , člen 7 CD 27 LG TNFSF 8 nadrodina tumor nekrotizujúceho faktora CD 30 LG(ligand), člen 8 TNFSF 9 nadrodina tumor...

Spôsob prípravy N-terminálom modifikovaných chemotaktických faktorov


Číslo patentu: E 3895

Dátum: 13.04.2004

Autori: Doods Henri, Wandl Robert, Lenter Martin, Necina Roman, Seidler Randolph

MPK: A61P 9/00, A61K 38/19, C07K 14/435...

Značky: přípravy, faktorov, modifikovaných, spôsob, chemotaktických, n-terminálom


...MCP-l proteínu izolovaného zprírodného zdroja je N-koniec blokovaný. Ako sa zístilo neskôr, toto naznačuje na posttranslačnú modiñkáciu, pri ktorej sa glutmnín, uvoľnený po odštiepenícagttcaatg atttgaatga cttcctggct atgctttcatccccatcctc tcacccccct cagatttaac ctćtccccct gagaccaacc aaagtctctg Ctcgctcagc gttatcatgg caagataagg gcagagcctg atccagctct gatcagggta cagaatctgg tgagtatcag gtggggctcc gacacttgta ttatataccc ctctgaggta ttttgttttt...

Spôsoby liečenia chorôb, pri ktorých je aktivita TNF-alfa škodlivá, nízkymi dávkami


Číslo patentu: E 10338

Dátum: 24.10.2003

Autori: Kaymakcalan Zehra, Kamen Robert

MPK: A61K 39/395, C07K 14/715, A61K 38/19...

Značky: nízkými, tnf-alfa, liečenia, spôsoby, škodlivá, chorôb, aktivita, dávkami, ktorých


...Boyle, P., et al. (1993) Cell. Immunol. 152569-581 zverejnená európska patentová prihláška č. 614 984 A 2 pôvodcov Boyle, et al. Bolo však uvedené, že tieto monoklonálne autoprotilátky odvodené od hybridómov majú afinitu khTNFa príliš nízku, než aby mohla byť počítaná bežnými metódami, nie sú schopné viazať rozpustný hTNFa a nie sú schopné neutralizovať cytotoxicitu vyvolanú hTNFa(viď vyššie Boyle, et al. ). Úspech metódy ľudských...

Lipozóm-cytokínová kompozícia a spôsob jej prípravy


Číslo patentu: 283596

Dátum: 12.09.2003

Autori: Cha Younsik, Collins David David, Brems David David

MPK: A61K 9/127, A61K 38/19

Značky: přípravy, spôsob, kompozícia, lipozóm-cytokínová

Zhrnutie / Anotácia:

Je opísaný spôsob prípravy stabilných kompozícií proteínov, v ktorom sa proteíny, ktoré sú schopné prechádzať do roztaveného globulárneho stavu, kontaktujú so záporne nabitým lipidovým vehikulom, čím sa proteín stabilizuje pred tepelne indukovanou agregáciou, denaturáciou a stratou aktivity. Proteín: fosfolipidový komplex priamo stabilizuje sekundárnu a terciárnu štruktúru proteínu a tieto kompozície sú použiteľné vo vysokoteplotných...

Antagonisty CXCR3-viažucich CXC chemokínov


Číslo patentu: E 1984

Dátum: 03.06.2003

Autori: Kosco-vilbois Marie, Proudfoot Amanda

MPK: C07K 14/435, C07K 19/00, A61K 38/19...

Značky: antagonisty, chemokínov, cxcr3-viažucich


...vkaždom chemokíne alebo vkaždej skupine vysoko homologických chemokínov sú takéto motívy Štruktúrované rozdielnym spôsobom. Niektoré ztýchto GAG-viažucich miest boli asociované so špecifickými konsenzus motívmi, ako napríklad BBXB (kde B znamená bázický zvyšok aX akýkoľvek iný zvyšok), alebo V iných usporiadaniach (Kuschert G a ďalší, 1999 Proudfoot A a ďalší, 2001).Hlavným dôsledkom tejto interakcie je agregovanie chemokínov, čo je...

Použitie mutovaných VEGF pre antiangiogénnu terapiu


Číslo patentu: E 10008

Dátum: 11.04.2003

Autori: Silva Rodríguez Ricardo, Bequet Romero Monica, Fernández Molina Luis Enrique, Gavilondo Cowley Jorge Victor, Vázquez Blomquist Dania Marcia, Acevedo Castro Boris, Musachio Lasa Alexis, Galban Rodríguez Ernesto, López Ocejo Omar

MPK: A61K 38/19, A61P 35/00

Značky: použitie, mutovaných, antiangiogénnu, terapiu


...hemangiómy (Wizigmann S. a Plate K.H., Histol. Histopathol. 11, 1049, 1996), V synoviálnej tekutine pacientov so zápalovými artropatiami (Bottomley M.J. et al., Clin. Exp. Immunol. 119, 182, 2000) a spojených s odmietnutim transplantátu (Vasir B. et al., 0008 Transplantation 71, 924, 2001). V konkrétnom prípade nádorov bunky exprimujú tri základné izoformy VEGF-Awl, VEGFA 1 a VEGF-Alw sú to tie bunky, ktoré rastú rýchlejšie in...

Chemokínové mutanty majúce zlepšenú biologickú dostupnosť


Číslo patentu: E 484

Dátum: 31.03.2003

Autori: Proudfoot Amanda, Wells Timothy, Kosco-vilbois Marie

MPK: A61K 38/19, A61P 29/00, A61P 31/00...

Značky: chemokínové, biologickú, majúce, mutanty, zlepšenú, dostupnost


...sa podáva I.P. (obrázok IA) alebo P.O. (obrázok IB). RANTES(K 45 E) sa podáva P.O. (obrázok IC). Dávky poskytujúce štatisticky významný účinok sú označené s .Obrázok 2 časový priebeh blokujúceho účinku RANTES variantu, mutovaného V 40 kovom konzervovanom dibázickom mieste, na RANTES-indukované zhromažďovanie perítoneálnych buniek. RANTES (R 44 AK 45 AR 47 A) sa podáva I.P. (obrázok 2 A) alebo P.O. (obrázok ZB). Dávky poskytujúce štatisticky...

Faktor nekrotizujúci tumory kombinovaný s interferónom pri demyelinizačných chorobách


Číslo patentu: E 2753

Dátum: 29.01.2003

Autor: De Luca Giampiero

MPK: A61K 38/19, A61K 38/17, A61K 38/21...

Značky: demyelinizačných, faktor, kombinovaný, interferónom, chorobách, nekrotizujúci, tumory


...deštrukcii mikroorganizmov, ktoré spôsobujú infekciu a napomáhaním náprave spôsobených poškodení. lnterferóny sú prirodzene vylučované infikovanými bunkami a boli prvý krát identifikované v 1957. Ich meno je odvodené od faktu, že interferujú s replikáciou a tvorbou vírusov.lnterferóny vykazujú antivírusovú aj antiproliferatívnu aktivitu. Na základe biochemických a imunologických vlastnosti sú prirodzene sa vyskytujúce ľudské interferóny...

Nový ligand cytokínu ZCYTOR17


Číslo patentu: E 11474

Dátum: 21.01.2003

Autori: Sprecher Cindy, Kuijper Joseph, Grant Francis, Dasovich Maria, Kuestner Rolf, Hammond Angela, Dillon Stacey, Gross Jane

MPK: C07K 14/52, A61K 39/395, A61K 38/19...

Značky: nový, ligand, cytokínu, zcytor17


...buniek bez aktivácie.0009 DATABASE EMBL identifikačné č. ACO 48338 (16. apríla 2000) opisuje 12 BAC RP 211-512 M 8 od Homo sapiens. DATABASE EMBL identifikačné č. AKO 05939 (8. februára 2001) opisuje cDNA. Musmusculus dospelých samčích semenníkov, rozšírená knižnica RIKEN s plnými dĺžkami, klonl 700013 B 14 produkt hypotetický proteín,úplná sekvencia inzertu.0010 Demonštrované in vivo aktivity rodiny cytokínov ilustrujú enormný klinický...

Terapeutické použitie G-CSF


Číslo patentu: E 10374

Dátum: 06.01.2003

Autori: Moukoko Didier, Pourquier Didier

MPK: A61K 38/18, A61K 38/19, A61P 25/00...

Značky: terapeutické, použitie, g-csf


...umožňuje jeho použitie tiež prizdravých osobách na vytvorenie štepov kostnej drene pre0010 SCF (skratka Stem Cell Factor, tzn. faktor stimulujúci kmeňové bunky) je tiež rastovým faktorom. Pôsobí najmä ako rastový faktor pre hematopoietických progenitorov a môže mobilizovať prechod kmeňových buniek kostnej drene do krvi. Pôsobí tiež na diferenciáciu a funkciu mastocytov. Pôsobí prostredníctvom špecifického receptora 2 rodiny tyrozinových kináz...

Chimérne TNF ligandy


Číslo patentu: E 4993

Dátum: 05.12.2002

Autori: Cantwell Mark, Prussak Charles, Kipps Thomas

MPK: C07K 14/435, A61K 38/19, A61P 35/00...

Značky: chimérne, ligandy


...najmenej časť domény IV sa môže odštiepiť od rodičovskej molekuly.Odštiepený fragment má často rovnakú biologickú aktivitu akoneporušený ligand a je konvenčne označovaný ako rozpustnáforma člena TNF rodiny.0006 Existujú dve bioaktívne formy TNFa. Jedna forma je integrovaná V membráne (mTNFa), tiež sa označuje ako pro-TNFa. Okrem toho existuje rozpustná forma (sTNFa) generovaná proteolytickým štiepením mTNFa. TNF signalizuje...

Použitie leptínu na liečbu lipoatrofie u ľudí a metóda stanovenia predispozície pre spomínanú liečbu


Číslo patentu: E 14611

Dátum: 22.10.2002

Autori: Depaoli Alex M, Garg, Oral Elif Arioglu, Taylor Simeon I

MPK: A61K 38/18, A61K 38/19, A61P 3/06...

Značky: spomínanú, ľudí, lipoatrofie, predispozície, použitie, leptínu, liečbu, metoda, stanovenia


...podávaním Ieptínu prekonala rezistencia myší na inzulln (Shimomura a kol., 1999). Na druhej strane, iné transgénne myši, ktoré sa vyznačovali génom A-ZIPIF-1, nedostatkom tukového tkaniva,vážnou rezistenciou na inzulín, cukrovkou a výrazne zníženými hladinami leptinu v sére,nereagovali na Ieptín pri podobných dávkach a vyššie dávky boli minimálne účinné(Gavrilova a kol., 2000). Účinnosť leptlnu sa tiež znižovala s vekom zvierat (Lg)....

Použitie kardiotrofínu pri pečeňových ochoreniach


Číslo patentu: E 5098

Dátum: 20.09.2002

Autori: Baixeras Llano Elena, Bustos De Abajo Matilde, Prieto Valtueńa Jesús, Lasarte Sagastibelza Juan José

MPK: A61P 1/00, A61K 38/19, C07K 14/435...

Značky: použitie, ochoreniach, kardiotrofínu, pečeňových


...už použitý pri liečení ochorení srdca a neurodegeneratívnych a neurologických ochoreniach(W 0 95/29237) ako modulátor miestnych zápalových procesov súvisiacich s receptorom LIFRB (W 0 97/30146), vrátane regulácie metabolizmu hepatocytu pri zápalových reakciách (16), zvlášť reakcie proteínu akútnej fázy (17) a presnejšie bola. vyvolaná expresia mRNA ľudského haptoglobínu a 22-manoglobinu (18) pri diagnóze a liečení nádorov (W 0 OO/43790) a pri...

Spôsob mobilizácie progenitorových/kmeňových buniek


Číslo patentu: E 11294

Dátum: 30.07.2002

Autori: Bridger Gary, Broxmeyer Hal, Henson Geoffrey, Macfarland Ronald Trevor, Calandra Gary, Abrams Michael, Dale David

MPK: A61K 38/19, A61K 31/33, A61K 31/555...

Značky: mobilizácie, spôsob, buniek


...5 612 478, 5 756 728, 5 801 281 a 5 606 053 a PCT publikácii WO O 2/26721 založenej na prihláške podanej 29. septembra 2000.0008 Skôr bolo zistené a opísané v PCT publikácii WO O 2/58653 založenej na prihláške podanej 1. februára 2000,že niektoré z polyamínových antivírusových činidiel opisaných v uvedených publikáciách majú vplyv na zvýšenie počtu bielych krviniek. Teraz bolo zistené, že polyamínové antivírusové činidlá opísané V uvedených...

Polypeptid mpl ligandu, jeho zodpovedajúca nukleová kyselina, expresný vektor a hostiteľská bunka, ktorá ho obsahuje, spôsob prípravy polypeptidu a jeho použitie


Číslo patentu: 282265

Dátum: 02.11.2001

Autori: Eaton Dan, De Savuage Frederic

MPK: C07K 14/52, C07K 16/24, A61K 38/19...

Značky: použitie, buňka, obsahuje, polypeptid, přípravy, kyselina, expresný, ligandu, nukleová, ktorá, spôsob, polypeptidů, zodpovedajúca, vektor, hostiteľská

Zhrnutie / Anotácia:

Je opísaný polypeptid mpl ligandu pripravený spôsobom, ktorý zahŕňa: (i) skríning humánnej genómovej knižnice s oligonukleotidom založeným na genómovej sekvencii znázornenej na obrázku 9 na izolovanie genómovej DNA, ktorá zahŕňa exón mpl ligandu kódujúci sekvenciu znázornenú na obrázku 9, spolu so zostávajúcimi exónmi génu, (ii) inzerciu DNA do expresného vektora, (iii) transfekciu cicavčej bunky génovým expresným vektorom a (iv) izoláciu...

Vektor zahŕňajúci gén kódujúci bielkovinu GM-CSF primátov, plazmid hostiteľská bunka, spôsob výroby bielkoviny, bielkovina GM-CSF primátov, cDNA zodpovedajúca génu kódujúcemu bielkovinu GM-CSF primátov


Číslo patentu: 280265

Dátum: 08.10.1999

Autori: Wang Elizabeth, Clark Steven, Wong Gordon, Kaufman Randal

MPK: C12P 21/02, C12N 15/27, A61K 38/19...

Značky: zahŕňajúci, vektor, genů, zodpovedajúca, kódujúcemu, spôsob, bielkovinu, plazmid, výroby, kódujúci, buňka, bielkoviny, gm-csf, primátov, bielkovina, hostiteľská

Zhrnutie / Anotácia:

Opisuje sa spôsob výroby lymfokínov, najmä bielkovín, ktoré majú schopnosť podporovať rast a diferenciáciu základných krvných buniek primátov a faktora CSF, ktorý podporuje tvorbu kolónií, pomocou techník rekombinantnej DNA, pričom sa použijú vektory obsahujúce gén kódujúci uvedenú bielkovinu a transformované mikroorganizmy a bunkové línie. Taktiež sa opisujú cDNA kódujúce bielkovinu CSF a spôsob čistenia týchto bielkovín.

Spôsob izolácie ľudského nekrotizujúceho faktora (TNF), ľudský TNF, zmes s obsahom TNF, variant TNF, DNA kódujúca TNF, bunka transformovaná s DNA a farmaceutický prostriedok


Číslo patentu: 279897

Dátum: 07.05.1999

Autori: Geloddel David Vannorman, Nedwin Glenn Evan, Lee Sang He, Aggarwal Bharat Bhushan

MPK: A61K 38/21, A61K 38/19, C07K 1/22...

Značky: buňka, faktora, spôsob, variant, ĺudský, prostriedok, transformovaná, kódujúca, tnf, farmaceutický, izolácie, obsahom, nekrotizujúceho, ľudského

Zhrnutie / Anotácia:

Spôsob izolácie ľudského nádoru nekrotizujúceho faktora (TNF) z heterogénnej zmesi s obsahom iných proteínov pozostáva z aplikácie kompozície na najmenej jeden silikát, sklo s kontrolovanou veľkosťou pórov, alkyl sefarózu alebo častice živice s vlastnosťou aniónového meniča s jednotnou veľkosťou, na absorpciu ľudského TNF a elúcie adsorbovaného ľudského TNF. Ďalej je opísaná zmes s obsahom ľudského TNF, variant TNF, DNA kódujúca TNF, bunka...