Polypeptidy so schopnosťou tvorby väzbových štruktúr na antigén so špecificitou pre Rhesus D antigény, DNA kódujúce také polypeptidy, spôsob ich prípravy a použitie

Je ešte 22 strany.

Pozerať všetko strany alebo stiahnuť PDF súbor.

Zhrnutie / Anotácia

Sú opísané polypeptidy schopné tvorby väzbových štruktúr na antigén, ktoré sú špecifické pre Rhesus D antigény. Získané polypeptidy, ktoré sú Fab fragmenty, sa môžu použiť priamo ako aktívna zložka vo farmaceutických a diagnostických prostriedkoch. Fab a ich DNA sekvencie sa môžu tiež použiť na prípravu kompletných rekombinantných anti-Rhesus D protilátok použiteľných vo farmaceutických a diagnostických prostriedkoch.

Text

Pozerať všetko

Predkladaný vynález sa týka polypeptidov, ktoré tvoria väzbové štruktúry na antigén so špecificitou pre Rhesus D antigény a najmä Fab molekúl so špecificitou pre Rhesus D antigén. Vynález sa tiež týka ich použitia pre farrnakologické a diagnostické prípravky. Uvedené Fab fragmenty, ak sú geneticky spracované tak, aby boli časťou kompletných protilátok, sú použiteľné na profylaxiu hemolytickej choroby novorodencov (HDN). Predkladaný vynález poskytuje nové DNA a aminokyselinové sekvencie uvedených polypeptidov.Tak sa môžu protilátky použiť na ochranu Rh negatívnej ženy pred alebo ihneď po pôrode Rh pozitívneho dieťaťa na zabránenie HDN v nasledujúcich tehotenstvách.Vynález tiež obsahuje použitie uvedených F ab molekúl bud samostatne, alebo v kombinácii s Fc konštantnými regiónmi ako kompletných protilátok na liečbu iných ochorení, pri ktorých môže byt prínosom použitie anti-Rhesus D imunoglobulínu napríklad na liečbu idiopatickej trombocytopenickej purpury.Okrem toho sa môže Rhesus D imunoglobulín použiť po chybnej transfúzii Rh pozitívnej krvi Rh negativnemu prijemcovi, na zabránenie senzibilizácie Rh D antigénom. Ďalej sa vynález týka použitia týchto Fab fragmentov a protilátok ako diagnostických činidiel.HDN je všeobecný názov pre hemolytickú anémiu plodov a novorodencov spôsobenú protilátkami matky. Tieto protilátky sú zamerané proti antigénom na povrchu fetálnych erytrocytov. Tieto antigény môžu patriť k Rhesus,ABO alebo inému systému krvných skupín.Rhesus systém krvných skupín obsahuje 5 hlavných antigénov D, C, c, E a e (Issit, P. D. Med. Lab. Sci. 45 395, 1988). D antigén je najdôležitejší z týchto antigénov,pretože je veľmi imunogénny a vyvoláva tvorbu Rhesus D protilátok počas Rhesus inkompatibilného tehotenstva a po transfúzii Rhesus inkompatibilnej krvi. D antigén sa nachádza približne u 85 kaukazskej populácie v Európe a o týchto jedincoch sa hovorí, že sú Rh pozitivní, Jedinci, ktorí nemajú D antigén, sa nazývajú Rh negatívni. Expresia D antigénu môže byt rôzna z dôvodov nízkej hustoty antigénu, ďalej známej ako slabé D alebo D, alebo z dôvodov čiastočnej antigenicity, známej ako čiastočné D antigény.Rhesus D antigén, membránový proteín erytrocytu, bol nedávno klonovaný a bola opísaná jeho primáma štruktúra(Le Van Kim, C. akol., PNAS 89 10925, 1992). Modelové štúdie ukázali, že Rhesus D antigén má 12 transmembránových domén s len veľmi krátkym spojovacím regiónom presahujúcim mimo bunkovú membránu alebo presahujúcim do cytoplazmy.Parciálne D fenotypy sa najskôr identifikovali u ľudí,ktorí mali D antigén na erytrocytoch, ale nemali aloanti-D v sére (Rose, R. R. a Sanger, R., Blood groups in man, Blackwell Scientific, Oxford, UK, 1975 Tippett, P. a kol., Vox Sanguínis, 70 123, 1996). Toto sa môže vysvetliť tak, že D antigén je mozaiková štruktúra s najmenej 9 odlišnými epitopmi (epDl až epD 9). Preto u niektorých ľudí s D variantom nemajú erytrocyty časť tejto mozaiky a protilátky sú namierené proti chýbajúcim D epitopom. Rh pozitivní jedinci, ktorí vytvárajú protilátky proti čiastočným D antigénom boli klasifikovaní do šiestich hlavných odlišných kategórií (D až DW), kde každá má inú abnorrnalitu D antigénu. Neskôr sa ukázalo, že tieto D kategórie dávajú rôz ny charakter reakcie pri testovaní proti panelu ľudských monoklonálnych anti-D protilátok (Tippett, P. a kol., Vox Sanguinis, 70 123, 1996). Podľa rôznych charakterov reakcie sa identifikovalo 9 epitopov a tak boli definované parciálne D kategórie. Počet epitopov prítomných na D antigéne sa líši medzi jednotlivými parciálnymi D kategóriami, ked DV kategória exprivuje najmenej, epD 3, 4 a 9. DV kategória je klinicky významná, pretože DVI ženy môže byt imunizované dostatočne silno na spôsobenie hemolytickej choroby novorodencov.Profylaktická účinnost anti-RhD IgG na prevenciu hemolytickej choroby novorodencov je dobre dokázaná a je rutinným postupom počas mnohých rokov. V dôsledku toho sa závažné ochorenie stalo raritou. Ale, základná príčina ochorenia, t.j. RhD inkompatibilita medzi RhD negatívnou matkou a RhD pozitívnym dieťaťom, stále zostáva a tak vyžaduje kontinuálne dodávanie terapeutíckého anti-RhD lgG.V posledných rokoch sa zabezpečenie kontinuálneho dodávania anti-RhD IgG stáva narastajúcim problémom. Zásoba dostupného hyperímúnneho séra od aloimunozovaných Rh negatívnych viacrodičiek sa výrazne znížila vďaka úspechu profylaktického podávania anti-RhD. Preto súčasné metódy produkcie vyžadujú opakovanú imunizáciu stále viac neochotnejších darcov na produkciu vysokého titra antiséra (Selinger, M., Br. J. Obstet. Gynaecol. 98 509,1991). Sú tu tiež asociované rizikové faktory a technické problémy, ako je použitie Rh pozitívnych erytrocytov na opakovanú imunizáciu, čo má riziko prenosu vírusových ochorení ako je hepatitída B, AIDS a iné dosiaľ neznáme vírusy (Hughes-Jones, N. C.m BR. J. Haematol. 70 263,1988). Preto je žiaduci altematívny spôsob na produkciu anti-RhD protilátok.V posledných niekoľkých rokoch sa skúšali rôzne altematívne zdroje hyperímúnneho séra, ale všetky sú spojené s nevýhodami. Transforrnácie lymfocytov vírusom Epstein-Barrovej (EBV) za vzniku B lymfoblastoidných bunkových linií, ktoré secemujú špecifickú protilátku vrátane protilátky proti Rhesus D antigénu (Crawford a kol., Lancet, 386 19. februára 1983) sú nestabilné a vyžadujú extenzívne klonovanie. Tiež z dôvodov nízkej účinnosti transformácie (1 až 3 B buniek) sa môže z potenciálneho repertoáru získat len obmedzený rozsah protilátkových špecificít. Ďalej sa zdá, že myši neodpovedajú na Rhesus D antigén a preto nie sú dostupné žiadne myšie monoklonálne protilátky, ktoré by sa mohli použit na výrobu chimerických alebo humanizovaných protilátok. Dosiaľ bola jedinou altematívou produkcia ľudských protilátok hybridomnou technikou, ktorá je tiež obmedzená chýbaním vhodného partnera na fúziu s ľudskými myelomovými bunkamiPredmetom predkladaného vynálezu preto sú Fab fragmenty, ktoré majú reaktivitu proti Rhesus D antigénu, rovnako ako kompletné protilátky s obsahom Fab fragmentov,ktoré nemajú uvedené nedostatky.V posledných niekoľkých rokoch technika repertoárového klonovania a konštrukcie fágových zobrazovacich knižníc otvorila nové možnosti na produkciu ľudských protilátok definovanej špecificity (Williamson, R. A. a kol.,PNAS 90 4141, 1993). Tieto metódy sa preto použili na prípravu polypeptidov schopných tvorby väzbových štruktúr na antigén so špecificitou pre Rhesus D antigény, najmäna prípravu Fab fragmentov, ktoré majú aktivitu proti Rhesus D a čiastočným D antigénom.Tvorba ľudských protilátok repertoárovým klonovaním ako bola opísaná V posledných rokoch (Barbas III, C. F. a Lemer, R. A. Companion Methods Enzymol. 2 119, 1991) je založená na izolácii mRNA z perifémych B buniek. Táto metóda ponúka nástroje na izoláciu prirodzených protilátok, autoprotilátok alebo protilátok tvorených počas imunitnej odpovede (Zebedee, S. L. a kol., PNAS 89 3175,1992 Vogel, M. a kol., Eur. J. Immunol. 24 1200, 1994). Táto metóda spočíva v konštrukcii knižnice rekombínantných protilátok od jednotlivých darcov z mRNA kódujúcej imunoglobulínovej (lg) molekuly. Pretože len lymfocyty perifémej krvi (PBL) sa môžu izolovať od darcu, sú šance na nájdenie B buniek produkujúcich špecifickú protilátku zvýšené, ak sa jedincovi podá dávka požadovaného antigénu tesne pred odberom PBL (Persson, M. A. A. a kol.,PNAS 88 2432, 1991). Celková RNA je potom izolovaná a mRNA lg repertoára sa môže klonovať s použitím Ig špecifických primérov v polymerázovej reťazovej reakcii (PCR),po ktorej nasleduje súčasná expresia ťažkých a ľahkých reťazcov Ig molekuly na povrchu filamentózneho fágu, čo vytvorí organizmus, ktorý analogicky s B bunkami môže viazat antigén. V literatúre je táto metóda tiež známa ako komhinatoriálny prístup, pretože umožňuje nezávislé kombinovanie ťažkých a ľahkých reťazcov za vzniku funkčného F ab fragmentu protilátky pripojeného na jeden z koncových proteínov, nazývaného plII, filamentózneho fágu. Fágy, ktoré nesú Fab molekuly (tu ďalej Phab častice) sa podrobia selekcii na požadovanú antigénnu špecificitu procesom známym ako biopanorámovanie. Antigén môže byt naviazaný na pevný nosič, keď sa špecifická Phab viaže na antigén, zatiaľ čo nešpecifické Phab sa vypláchnu a nakoniec sa špecifické Phab eluujú z pevného nosiča. Špecifické Phab sa potom amplifikujú v baktériách, uskutoční sa opakovaná väzba na antigén na pevnom nosiči a celý postup biopanorámovania sa opakuje.Postupné opakovanie panorámovanía a amplifikácie vybranej Phab v baktérií vedie k obohateniu špecifických Phab, čo sa pozoruje zo vzostupu titra kolónie tvoriacich jednotiek (cfu) očkovaných na platne po každom cykle panorámovania. Naše skoršie skúsenosti a publikované údaje naznačujú, že špecifický fág môže byt detegovaný obvykle po 4 až 6 cykloch panorámovania (V ogel, M. a kol., Eur. J. Immunol. 24 1200, 1994). V uvedenej citácii však nie je žiadna zmienka, že naznačené kroky sa môžu použiť na prípravu Fab fragmentov antí-RhD protilátok.Prehľad obrázkov na výkresochObr. 1 a až 16 b ukazujú DNA sekvencie kódujúce variabilné regióny (V regióny) anti-RhD Fab fragmentov a zodpovedajúce polypeptídove sekvencie.Obr. 17 ukazuje pComb 3 expresný vektor použitý podľa predkladaného vynálezu.Obr. 18 a 19 ukazujú oddelenú prípravu génov pre ťažký a ľahký reťazec kompletnej protilátky podľa opisu v príklade 6.Predmetom predkladaného vynálezu sú polypeptidy schopné tvorby väzbových štmktúr na antigén so špecificitou na Rhesus D antigény podľa definície V nároku 1. Tabuľka v nároku 1 sa vzťahuje k pripojeným obrázkom. .le uvedené identifikačné číslo pre každú sekvenciu. Lokalizácie Rhesus D špecifických CDR 1 (komplementaritu určujúci región 1), CDR 2 a CDR 3 regiónov sú uvedené na obrázkoch a podľa číslovania párov báz V tabuľke nároku 1.Výhodnýmí polypeptidmi podľa predkladaného vynálezu sú anti-Rhesus D protilátky, ktoré obsahujú variabilné regióny ťažkých a ľahkých reťazcov sekvencií uvedených na obr. la až 16 b. Obrázky la, 2 a 16 a sa týkajú variabilných regiónov ťažkých reťazcov a obrázky lb, 2 bl 6 b sa týkajú variabilných regiónov ľahkých reťazcov.Ďalšími predmetmi predkladaného vynálezu sú DNA sekvencie kódujúce antigén väzbové polypeptidy podľa nároku 6. Výhodné DNA sekvencie sú tie, ktoré kódujú variabilné regióny Fab fragmentov anti-RhD protilátok podľa obrázkov la až 16 b. Obrázky la, 2 al 6 a sa týkajú ťažkých reťazcov a obrázky lb, 2 bl 6 b sa týkajú ľahkých reťazcov.Ďalším predmetom predkladaného vynálezu je spôsob na prípravu rekombínantných Fab polypeptidov podľa nároku ll.Ďalším predmetom predkladaného vynálezu je spôsob na selekciu rekombínantných polypeptidov podľa nároku 12.Ďalším predmetom predkladaného vynálezu sú anti-RhD protilátky podľa nároku 14, výhodne anti-RhD imunoglobulínové molekuly, ktoré obsahujú variabilné regióny ťažkého a ľahkého reťazca podľa obrázkov la až 16 b v kombinácii so známymi konštantnýrni regiónmi ťažkého a ľahkého reťazca.Ďalším predmetom predkladaného vynálezu sú famiaceutické a diagnostické prostriedky, ktoré obsahujú polypeptidy, anti-RhD protilátky alebo Fab fragmenty podľa predkladaného vynálezu.Celková reamplifikovaná Phab populácia získaná po každom panorámovaní sa môže testovat na špecificitu s použitím rôznych metód ako je ELISA a imunologické bodové testy. Toto je tiež určené charakterom antigénu, napríklad anti-Rhesus D Phab sú detegované nepriamou hemaglutináciou s použitím králíčej anti-fágovej protilátky alebo ekvivaletného Coombsovho činidla ako skríženej väzbovej protilátky. Po identifikácii celkovej Phab populácie ako pozitívnej pre požadovaný antigén sa jednotlivé Phab klony izolujú a sekvencuje sa DNA kódujúca požadované Fab molekuly. Jednotlivé Fab sa môžu potom vyrobiť s použitím pComb 3 expresného systému, ktorý je zobrazený na obr. 16. V tomto systéme je gIII gén, ktorý kóduje koncový proteín plII, vystrihnutý z fagemidového vektora pComb 3. Toto umožňuje produkciu solubilného Fab v periplazme baktérie. Také jednotlivé Fab fragmenty sa môžu potom testovat na antigénnu špecificitu.Fágový zobrazovací prístup sa tiež použil ako prostriedok na získanie monoklonálnych protilátok z nestabilných hybridornných bunkových línií. Toto bolo opísané pre anti-Rhesus D protilátky (Siegel, D. L. a Silberstein, L. E. Blood, 83 2334, 1994 Dziegiel, M. a kol., J. Immunol Methods, 182 7, 1995). Fágová zobrazovacia knižnica konštruovaná od neimunizovaných darcov sa tiež použila na selekciu F v fragmentov (t.j. variabilných regiónov ťažkého a ľahkého reťazca, VH a VL) špecifických pre antigény ľudských krvných skupín, ktoré obsahujú jeden Fv fragment reaktívny s Rhesus D antigćnom (Marks, J. D. a kol., Biotechnology, ll 1145, 1993).Dôležitými podmienkami pri konštrukcii kombinatoriálnych knižníc sú zdroje buniek použitých na extrakciu RNA a charakter antigénu použitého na panorámovanie. Preto predkladaný vynález používa hyperimúnneho darcu,ktorému bola podaná i. v. dávka Rhesus D erytrocytov. PBL darcu sa odoberú 5 a 18 dní po i. v. dávke a použijú sa na konštrukciu 2 kombinatoriálnych knižníc tu ďalej označovaných ako lmižnica D 1 (LD 1) a knižnica D 2 (LD 2), v príslušnom poradí. Dvojitá imunofluorescenčná analýzazískaných PBL, s použitím markerov CD 20 a CD 38 na spektrum B buniek a lymfoblastoidných buniek, v príslušnom poradí, ukázala vyššie ako normálne percento lymfoblastoidných B buniek, morfológíe plazmatických buniek. Vyšší počet plazmatických buniek nájdených v periférnej krvi je neobvyklý, pretože v periférií je normálne menej ako 1 a pravdepodobne ukazuje na to, že darca mal vyššie percento cirkulujúcich B buniek so špecíficitou pre Rhesus D antigén.Na konštrukciu knižnice sa selekcia Phab špecifických pre Rhesus D antigén uskutočnila biopanorámovaním čerstvých celých erytrocytov fenotypu RIR (CDe/CDe), t.j. referenčných buniek pre Rhesus D typizáciu. Toto bolo nevyhnutné, pretože Rhesus D antigén, integrálny membránový proteín so 417 aminokyselinami (Le Van Kim, C. a kol., PNAS 89 10925, 1992), stráca svoju ímunogenicítu počas prečistenia (Paradis, G a kol., J. Immunol. 137 240,1986), a preto nemôže byt chemicky prečistený D antigén naviazaný na pevnú fázu na selekciu imunoreaktivnych Phab ako je to uskutočnené pre iné antigénne špecificity skôr selektované v tomto systéme (Vogel, M. a kol., Eur. J. Immunol. 24 1200, 1994). Modelové štúdie ukázali, že len veľmi krátky spojovací región Rhesus D antigénu presahuje mimo bunkovú membránu alebo presahuje do cytoplazmy(Chérif-Zahar, B. a kol., PNAS 87 6243, 1990). Preto sú časti RhD antigénu rozpoznateľné protilátkami relatívne obmedzené a môžu byt konfomiačne obmedzené. Tento aspekt Rhesus D antigénu sa stáva ešte dôležitej ším pri selekcii Phab s reaktívitou proti čiastočným D fenotypom,ktorým chýbajú niektore definované epitopy D membránového proteínu (Mouro, I. a kol., Blood. 83 1129, 1994).Okrem toho, pretože celé erytrocyty neexprivujú len D antigén, musí sa uskutočnil séria negatívnych absorpcii na Rhesus D negatívnych erytrocytoch z toho dôvodu, aby sa odabsorbovalí tie Phab, ktoré reagujú s inými antigénnymi proteínmi na erytrocytoch.Tento panorámovací postup uskutočnený na Phab z obidvoch LD 1 a LD 2 knižníc viedol k izolácíi 6 rôznych klonov, ktoré produkujú Fab z knižnice LD 1, 8 rôznych klonov, ktore produkujú F ab z knižnice 2 a 2 klonov, ktore produkujú Fab zo súboru knižníc LD 1 a LD 2.Nomenklatúra a obrázky, kde sú sekvencie opísané, sú uvedené v tabuľke 1.Knižnica VH- VL- Knižnica VH- VLLD 1 sekven. sekven. LD 1 sekven. sekven. klon č. obrázok obrázok klon č. obrázok obrázokmala by rekombinantná knižnica tiež obsahovat anti-DVI špecificitu.Na selekciu DVI reaktivity sa podmienky na panorámovanie zmenili v tom, že sa použili iné bunky. Špeciálny darca, ktorého erytrocyty boli typizované a bolo známe, že exprivujú čiastočný DVI fenotyp, sa použil ako zdroj buniek na opakované panorámovanie LD 1 a LD 2 knižníc. Táto druhá séria panorámovania sa uskutočnila v podstate rovnakým spôsobom ako prvá séria s výnimkou substitúcie DVI erytrocytov za RIRl erytrocyty a pridania ošetrenia DVI erytrocytov bromelázou. DVI fenotyp exprivuje najmenej Rhesus D epitopov a je preto ťažké vyrobit proti nemu protilátky. Bolo opísané, že len 15 neselektovaných polyklonálnych anti-D a 35 selektovaných anti-D tvorených Rhesus D negatívnyrni subjektmi reaguje s DVI bunkami (Mouro, l. a kol., Blood, 83 1129, 1994). Ošetrenie bromelázou, ktorá odstraňuje kyselinu N-acetylneuramínovú (kyselinu sialovú) z membrány erytrocytov sa uskutočnilo preto, aby boli epitopy Rhesus DVI ľahšie dosiahnuteľné počas panorámovania s preabsorbovanými Phab.Táto druhá séria panorámovania na LD 1 knižnici viedla k zisku 1 klonu produkujúceho Fab, LD 1-6-17. Nomenklatúra je uvedená v tabuľke 2.Tabuľka 2 Knižnica LD 1 VH-sekvencía VL-sekvencia obrazok obrazok Klon č. LD 1-6-17 14 a 14 bAle tento klon reagoval s Rhesus alelami C a E a mal falošné pozitívnu reakciu s DVI pozitívnymi erytrocytmi. Toto bolo spôsobené tiež fenotypom DVI darcu (Cc DVI ee), ktorý exprivoval C alelu, ktorá nebola odabsorbovaná Rhesus negatívnymi erytrocytmi (ccddee).Preto sa uskutočnila tretia séria panorámovania na súbore LD 1 a LD 2 knižníc s použitím iných erytroeytov pre absorpčnú fázu. Po 6 cykloch panorámovania s použitím tak bromelázou ošetrených, ako bromelázou neošetrených erytrocytov pre obidva absorpčné kroky a elúciu z DVI pozitívnych erytrocytov sa získala celková populácia Phab,ktorá reagovala výlučne s erytrocytmi fenotypu RIRl(CCDDee), a 2 rôzni darcovia exprivujúci DVI variant.Táto tretia séria panorámovania na LD 1 knižnici viedla k zisku 2 klonov produkujúcich Fab, ktoré reagovali s DVI erytrocytmi. Nomenklatúra je uvedená v tabuľke 3.LD 1-40 la lb LD 2- l 6 a 6 b LD 1 -52 2 a 2 b LD 2-4 7 a 7 b LD 1 -84 3 a 3 b LD 2-5 Sa Sb LD 1-HO 4 a 4 b LD 2-10 9 a 9 b LD 1-l 17 Sa Sb LD 2-l l 10 a 10 bUvedené Fab klony majú výlučnú reaktivitu s Rhesus D antigénom, 3 a 5 DU testovaných erytrocytov a aglutinačnú reaktivitu proti čiastočným D fenotypom Rh 33, DIII, DIVa, DIVb, DVa, DVIl.Ale s použitím uvedených RIRl erytrocytov na panorámovanie Phab neboli izolované žiadne klony reaktívne s čiastočným DVI fenotypom. Pretože bolo známe, že sérum pôvodného hyperimúnneho darcu testované v čase tvorby rekombinantnej knižnice je reaktíwie s DVI fenotypom, Tabuľka 3 Knižnica LD 1/LD 2 VH-sekvencia VL-sekvencia obrazok obrazok Klon č. LD 1/2-6-3 15 a 15 b Klon č. LDl/2-6-33 16 a 16 bTak sa izolovalo 16 rôznych anti-Rhesus D Fab klonov. DNA z týchto klonov sa izolovala a sekvencovala s použitím lluorescenčného cyklického sekvencovania na ABI 373 A Sequencing System. Nukleotidové a zodpovedajúce aminokyselinove sekvencie uvedených Fab klonov tvoria základ predkladaněho vynálezu.Analýza sekvencie ukázala, že sa izolovalo niekoľko klonov s rovnakým VH gěnovým segmentom, ale s inými VL génovými segmentmi. Tak je to v prípade dvoch klonov LD 2-l a LD 2-10, dvoch klonov LD 2-4 a LD 2-ll a troch klonov LD 2-14, LD 1/2-6-3 a LD 1/2-6-33, v príslušnom poradí.Získané DNA sekvencie a Fab fragmenty sú použiteľné na prípravu kompletných protilátok, ktoré majú aktivituproti Rhesus D antigénu. Vhodnými expresnými systémami na také protilátky sú myšie myelomové bunky alebo ovariálne bunky čínskeho škrečka.Nasledujúce príklady podrobne opisujú vynález bez akéhokoľvek obmedzenia rozsahu vynálezu.Príklad l opisuje konštrukciu 2 kombinatoriálnych knižníc najmä uvedených LDl a LD knižníc.Príklad 2 opisuje podrobne sériu panorámovania na LDl a LD 2 knižniciach s použitím RlRl erytrocytov.Príklad 3 opisuje sériu panorámovania s použitím tak bromelázou ošetrených, ako bromelázou neošetrených erytrocytov na absorpciu a bromelázou ošetrených DVI pozitívnych erytrocytov s použitím súboru uvedených LDl a LD 2 knižníc.Príklad 4 opisuje nepriamy hemaglutinačný test, ktorý využíva králičiu antifágovú protilátku ako ekvivalentné Coombsove činidlo, na sledovanie obohatenia a špecificity Rhesus D špecifických Phabs po panorámovani.Príklad 5 opisuje pripravu a prečístenie Fab fragmentov protilátky na použitie ako diagnostické činidlo.Príklad 6 opisuje prípravu kompletných anti-Rhesus D imunoglobulínov s použitím sekvencií podľa predkladaného vynálezu.Príklad l Konštrukcia rekombinanmých LDl a LD knižnícDospelému mužovi, ktorý bol členom dobrovoľnej základne hyperimúnnych Rhesus D darcov, sa podala i. v. dávka 2 ml pripravených erytrocytov od známeho mužského darcu lqvnej skupiny 0 RhDŤ PBL sa odoberali V deň 5 a 18 po dávke a mononukleáme bunky sa izolovali centrifugáciou s Ficollovým gradientom (Lymphoprep,Pharmacia, Milwaukee, W 1). Výsledky analýzy darcovských lymfocytov v deň 5 sú uvedené V tabuľke 4. MNC z dňa 5 sa použili priamo na prípravu RNA s použitím postupu fenol-chloroform-guanidiniumizotiokyanát (Chomczynski, P. a Sacchi, N. Anal. Biochem. 162 156, 1987). MNC zo dňa 18 sa najskôr kultivovali počas 3 dní v RPMI-1640 médiu (Seromcd, Basel) s obsahom 103 U/ml IL-2 (Sandoz Research Center, Vienna, Austria) a 10 ug/ml mitogénu z ličidla amerického (PWM Sigma L 9379,Buchs, Switzerland) pred extrakciou RNA.Tabuľka 4 Imunofluorescenčná analýza darcovských lymfocytov vĚĚÉĚÍĚJÝ Wwzitív- ŽĚÉĚSJÝSS P°zivtí à nych buniek ügćš nych buniekSkonštruovali sa jednotlivé knižnice nazvané LDl a LD 2 (ako je podrobnejšie uvedené) zodpovedajúce bunkám odobraným v deň 5 a 18 (spolu 21 dni vrátane 3 dní PWM stimulácie) po i. v. dávke, v príslušnom poradí. Celková RNA sa potom pripravila z týchto buniek s použitímpostupu fenol-chloroform-guanidíniumizotiokyanát. Z tejto RNA sa lO g použilo na výrobu cDNA s použitím oligo(dT)priméru (400 ng) a reverzne sa transkribovalo s použitím M-MuLV reverznej transkriptázy podľa návodu dodávateľa (Boehringer Mannheim Germany). PCR amplifikácia sa uskutočnila podľa postupu opisaného vo Vogel, M. a kol., E. J. of Immunol. 24 1200, 1994. Stručne, 100 l PCR reakcie obsahovalo Perkin-Elmer pufor s 10 mM MgClz, 5 l cDNA, 150 ng každého vhodného 5 a 3 priméru, všetky štyri dNTP - 200 M každý a 2 U/ml Taq polymerázy (Perkin Elmer, NJ). PCR amplifikácia ťažkého a ľahkého reťazca Fab molekuly sa uskutočnila jednotlivo so súborom primérou od Stratacyte (podrobnosti sú uvedene ďalej). Pre ťažký reťazec sa použilo šest upstrearn primérov, ktoré hybridizovali s každou zo šiestich rodín VH génov, zatial čo primér pre jeden K a jeden Ä reťazec sa použil pre ľahký reťazec. Downstream priméry boli navrhnuté tak, aby zodpovedali pantovému regiónu konštantných domén 1 a 3 pre ťažký reťazec. Pre ľahký reťazec zodpovedali downstream priméry 3 koncu K a Ä konštantných domén. PCR produkty ťažkého a ľahkého reťazca sa zhromaždili oddelene, pričom sa prečistili na géli a trávili Xhol/Spel a Sacl/Xbal reštrikčnými enzýmami (Boehringer Mannheim), v príslušnom poradí. Po trávení sa produkty PCR extrahovali jedenkrát fenol chloroforrn izoamylalkoholom a prečistili sa gélovou excisiou. Inzercia Xhol/Spel tráveného Fd fragmentu a následná ligácia Sacl/Xbal tráveného reťazca do pComb 3 vektora, transformácia do XLl-Blue buniek a produkcia fágov sa uskutočnili podľa postupu opísaného v Barbas III, C. F. a Lerner, R.A. Companion Methods Enzyrnol. Z 119, 1991.Po transfonnácii XLl-Blue E. colí buniek sa odoberali vzorky a titrovali sa na platniach na určenie veľkosti knižnice. Tieto výsledky ukazujú expresné knižnice s 5 x 105 a 7,7 x 106 cfu (kolónie tvoriace jednotky) pre LDl a LD 2, v príslušnom poradí.VHI 5-CAC TCC CAG GTG CAG CTG CTC GAG TCT GG-3VHII 5-GTG CTG TCC CAG GTC AAC TTA CTC GAG TCT GG-3 vrrrn 5-GTC CAG GTG GAG GTG CAG CTG CTC GAG TCT GG-3 VHIV 5-GTC CTG TCC CAG GTG CAG CTG CTC GAG TCG GG-3 V 1-V 5-GTC TGT GCC GAG GTG CAG CTG CTC GAG TCT GG-s V 1-V 1 5-GTC CTG TCA CAG GTA CAG CTG CTC GAG TCA GG-3 CHI(gI) 5-AGC ATC ACT AGT ACA AGA TTT GGG CTC-Svw) 5-GT GCG AGA TGT GAG CTC GTG ATG ACC CAG TcT CCA-3 CL(k) 5-T CCT TCT AGA TľA CTA ACA CTC TCC CCT GTT GAA GCrCTT TGT GAC GGG CGA ACT c-3VLQSCTGCACAGGGTOCTGGGCCGAGCTCGTGGTGACľCA-J CL(I) 5 G CAT TcT AGA CTA TTA TGA ACA TTC TGT AGG GGC-JpComb vektor použitý na klonovanie Fd a ľahkého reťazca sa získal od Scripps Research Institute La Jolla, CA Barbas III, C. F. a Lemer, R. A. Companion Methods Enzyrnol. 2 119, 1991. Escheríchia coli kmeň XLl-Blue použitý na transformáciu pComb 3 vektora a VCSM 13 pomocný fág sa zakúpili od Stratacyte (La Jolla, CA).Príklad 2 Selekcia Rhesus D Phab z LDl a LD 2 knižníc na RlRl e rytrocytochSérie troch negatívnych absorpcií na erytrocytoch skupiny 0 Rh negatívne sa uskutočnili pred každým cyklom panorámovania pred pozitívnou selekciou na erytrocytoch skupiny 0 Rh pozitívne (RlRl). Čerstvé erytrocyty sa odobrali v ACD (kyslá citrátová dextróza) antikoagulačnom činidle a premyli sa 3-krát v 0,9 NaCl. Erytrocyty sa počitali V Ha

MPK / Značky

MPK: G01N 33/80, C12N 15/13, C12N 15/62, A61K 39/395, C07K 16/18

Značky: väzbových, špecificitou, kódujúce, spôsob, antigény, schopnosťou, antigen, také, použitie, přípravy, rhesus, struktur, tvorby, polypeptidy

Odkaz

<a href="http://skpatents.com/61-284879-polypeptidy-so-schopnostou-tvorby-vazbovych-struktur-na-antigen-so-specificitou-pre-rhesus-d-antigeny-dna-kodujuce-take-polypeptidy-sposob-ich-pripravy-a-pouzitie.html" rel="bookmark" title="Databáza patentov Slovenska">Polypeptidy so schopnosťou tvorby väzbových štruktúr na antigén so špecificitou pre Rhesus D antigény, DNA kódujúce také polypeptidy, spôsob ich prípravy a použitie</a>

Podobne patenty