Archív za 2005 rok

Strana 36

Inhibítory proteínu podobného angiopoetínu 4, kombinácie a ich použitie

Načítavanie...

Číslo patentu: E 7068

Dátum: 19.07.2005

Autori: Ferrara Napoleone, Gerber Hans-peter, Liang Xiao Huan

MPK: C07K 16/00

Značky: proteínu, podobného, kombinácie, angiopoetínu, použitie, inhibitory

Text:

...vynálezu ANGPTL 4 antagonista je molekula SiRNA. Vjednom uskutočnení SiRNA molekula je ANGPTL 4-SiRNA molekula, kde molekula je zameraná na sekvenciu DNA (napriklad GTGGCCAAGCCTGCCCGAAGA, SEQ lD N 03) nukleovej kyseliny kódujúcej ANGPTL 4.0015 Poskytujú sa spôsoby blokovania alebo redukovania rastu nádoru alebo rastu rakovinových buniek. Vurčitých uskutočneniach spôsoby zahŕňajú podávanie účinného množstva antagonistu podobného...

Spôsob a príslušné zariadenie na výrobu dlhých oceliarskych produktov bez prerušenia

Načítavanie...

Číslo patentu: E 6381

Dátum: 19.07.2005

Autor: Arvedi Giovanni

MPK: B21B 1/46

Značky: oceliarskych, spôsob, výrobu, produktov, prerušenia, zariadenie, dlhých, příslušné

Text:

...ohľadne kvality produktu a s ohľadom na možnosti vzniku trhlin na valcovacích valcoch v dôsledku ich ohrevu. Zvýšenie priemernej teploty ako dôsledku vyššej teploty v oblasti jadra umožňuje, aby teplota povrchu bola nižšia ako 1200 °C, atým umožňuje vyhnúť sa vyššie uvedeným problémom.0008 Rovnako tak bolo zistené, že priaznivé účinky tohto typu valcovania spočívajúceho v priamom spojení do linky s kontinuálnym liatím, čiže, inak povedané,...

Farmaceutická kompozícia obsahujúca gabapentín

Načítavanie...

Číslo patentu: E 12944

Dátum: 19.07.2005

Autori: Grassano Alessandro, De Lazzari Alessandra, Rampoldi Luca

MPK: A61K 31/195, A61K 9/14, A61K 9/48...

Značky: kompozícia, gabapentin, farmaceutická, obsahujúca

Text:

...látok schopných nepodporovať konverziu gabapentínu na zodpovedajúce laktámové prímesi,ktorá obsahuje(i) kĺzne činidlo Vybraté z vápenatej soli slabej kyseliny, EP 1 784174 34 326/H(ii) lubrikačné činidlo vybraté zhydrogenovaného ricínového oleja a gIyceroI-behenátu a prípadne(iii) riedidlo, samotné alebo zmiešané s jedným alebo viacerými ďalšími riedidlami, vybraté z monosacharidového cukru, ako je napríklad sorbitol,xylitol, manitol,...

Sulfoaluminátový slinok s vysokým obsahom belitu, spôsob jeho výroby a jeho použitie na prípravu hydraulických spojív

Načítavanie...

Číslo patentu: E 5998

Dátum: 19.07.2005

Autori: Li Guanshu, Gartner Ellis

MPK: C04B 28/00, C04B 7/00

Značky: přípravu, slinok, belitu, výroby, vysokým, hydraulických, obsahom, použitie, sulfoaluminátový, spôsob, spojív

Text:

...hydraulických cementov medzi nimi systémy založené na kalciumalluminátoch (altematívne hlinitan vápenatýyalebo kalciumsulfátoch .Cementy svysokým obsahom hliníka ako Cement Fondu od LAFARGE sú známe z dôvodu ich schopností získať zvýšenú odolnost za krátky čas ale niekedy vytvárajú dobreznámy problém konverzie, ktorý je sprevádzaný prepadom mechanickej odolnosti a navyše ich výroba vyžaduje vysoko špecializované zariadenia, veľkú spotrebu...

Nové fenylaminopyrimidínové deriváty ako inhibítory bcr-abl kinázy

Načítavanie...

Číslo patentu: E 12672

Dátum: 19.07.2005

Autori: Podili Khadgapathi, Kompella Amala Kishan, Rachakonda Sreenivas, Venkaiah Chowdary Nannapaneni, Adibhatla Kali Satya Bhujanga Rao

MPK: A61K 31/506, C07C 233/66, A61P 35/02...

Značky: deriváty, fenylaminopyrimidínové, inhibitory, bcr-abl, nové, kinázy

Text:

...alebo radukálom vzorca H 2 N-CH(R)-C(O)7 NH-, kde R je vodlk, C 1-C 4 alkyl, benzyl. hydroxymetyl, í-hydroxyetyl. merkaptometyl. Z-metyltio-etyl. Indol-S-yl-metyl, fenyl-metyl, t-hydroxy-fenyl-metyl, karbamoyl-metyl,R 2 je C 1-C 6 alkyl. C 1-C 3 alkoxy. chlór, bróm. jód. trifluórrnetyl. hydroxy, fenyl. amino, mono(C 1-C 3 alkyl)amíno, di(C 1-C 3 aIkyl)amino, C 2-C 4 alkanoyl, propenyloxy, karboy. karboxy-metoxy,...

Kompozícia obsahujúca statíny a omega-3 mastné kyseliny

Načítavanie...

Číslo patentu: E 16575

Dátum: 19.07.2005

Autor: Cavazza Claudio

MPK: A61K 31/05, A61K 31/122, A61K 31/045...

Značky: statiny, mastné, kompozícia, obsahujúca, omega-3, kyseliny

Text:

...vynálezu uplatňuje prekvapivý účinok nainzulínovú rezistenciu, ktorý nie je predvídateľný na základe našich poznatkov ojednotlivých zložkách a ich kombinácia V každom prípade vedie k neočakávanćmu synergickému účinku.0018 Pre odbomíkov v odbore je evidentnou výhodou mat takúto kombináciu. Je naozaj možné liečiť inzulínovú rezistenciu a s ňou spojené patologické formy, najmä pokiaľ ide o následky abnonnálneho stavu lipidov a súčasne...

Skľučovadlo na upnutie upevňovacích prvkov na spojenie trecím zváraním

Načítavanie...

Číslo patentu: E 15784

Dátum: 19.07.2005

Autor: Mauer Dieter

MPK: B23K 20/12

Značky: zváraním, upevňovacích, prvkov, skľučovadlo, třecím, spojenie, upnutie

Text:

...neotočné zdvíhadlo, ktoré je axiálne posúvateľné do prstencového upnutia, a ktoré saxiálnym unášaním a rozpojiteľným spôsobom zaberá do prítlačného kusu na jeho strane odvrátenej od upevňovacieho prvku, a že prítlačný kus sa pri dosiahnutí polohy trecieho zvárania upevňovacieho prvku s prstencovým upnutím zablokuje tak, že prstenoové upnutie prenáša na prítlačný kus na seba pôsobiace rotačné sily spoločne s tlakovýmí silami, pričom zdvihadlo...

Epoxidové živice so zlepšenou pružnosťou

Načítavanie...

Číslo patentu: E 4574

Dátum: 18.07.2005

Autori: Fischer Thomas, Lunzer Florian, Grasböck Rosemaria, Reisinger Sandra

MPK: C08G 59/00

Značky: živice, zlepšenou, pružnosťou, epoxidové

Text:

...vynález sa tiež týka spôsobu výroby epoxidovej živice ABC, ktorá je riedíteľná vodou. a to začlenením produktu C reakcie alifatického poIyoIu C 1, ktorý vo svojej štruktúre obsahuje aspoň 20 hmotn. oxyetylénových skupín a ktorý má čiselný priemer molárnej hmotnosti M od 200 g/mol do 20 000 g/mol, s epoxidovou živicou C 2, ktorá obsahuje aspoň dve epoxidové skupiny v každej molekule a ktorá obsahuje epoxidové skupiny v množstve 0,5 moilkg až...

Jednokoľajné vozidlo

Načítavanie...

Číslo patentu: E 4176

Dátum: 18.07.2005

Autor: De Siqueira Indio Da Costa Luiz Augusto

MPK: B61B 13/04

Značky: vozidlo, jednokoľajné

Text:

...obdobný kanál uzatvorený V hornejfčastiS výnimkou úzkej štrbiny, ktorou prechádza spojovací prvok prespojenie medzi telesom vozidla a hnacím ústrojenstvom, ktoréje uložené vo vnútri kanála.0008 Ďalší variant jednokoľajného vozidla je opísaný v patentových spisoch US 5 456 183 a US 6 012 396. V súlade s týmto variantom je využívaný priestor verejných ciest vo výške dostatočnej na to, aby aspoň osobně vozy mohli prechádzať priamo pod...

Systém a podružná stanica elektrického napájania trakčnej siete

Načítavanie...

Číslo patentu: E 3564

Dátum: 18.07.2005

Autori: Moreau Patrice, Cornic Daniel

MPK: B60M 3/00

Značky: stanica, napájania, systém, siete, elektrického, trakčnej, podružná

Text:

...tu bude podrobne opísaná iba podružná stanica 20.0014 Podružná stanica 20 obsahuje vstup 26 nízkeho striedavého napätia, ktoré sa má usmerňovať. a výstup 28 usmerneného rovnomerného napätia.0015 Ako nizke napätie je tu označované napätie nižšie ako 1000 VAC, presnejšie ako nízke napätie kategórie B, alebo nnB, je označované napätie medzi 500 a 1 000 V AC.0016 Vstup 26 je tu prostredníctvom elektrického spojenia 30 pripojený k sieti B, čo je...

Spôsob ovládania krokového motora

Načítavanie...

Číslo patentu: 284658

Dátum: 18.07.2005

Autori: Kizler Alfred, Herzog Bernhard, Steger Roland

MPK: H02P 8/22

Značky: motora, ovládania, spôsob, krokového

Zhrnutie / Anotácia:

Spôsob ovládania krokového motora na pohon ukazovateľa ukazovacieho prístroja, pri ktorom sa v riadiacom prístroji (13) určuje dĺžka kroku a smer otáčania krokového motora (9) a vydáva sa do ovládacieho usporiadania na ovládanie krokového motora (9), takže pri každom krokovom taktovacom signáli riadiaceho prístroja (13) sa uskutoční jeden krok, a pri ktorom dĺžka kroku vydaná riadiacim prístrojom (13) sa ovládacím zapojením rozdelí na viac...

Integrálny odplynovač s rekuperatívnym výmenníkom

Načítavanie...

Číslo patentu: 284651

Dátum: 18.07.2005

Autor: Liko Ľudovít

MPK: F28B 9/00, F28B 1/00

Značky: výmenníkom, rekuperatívnym, integrálny, odplyňovač

Zhrnutie / Anotácia:

V hornej časti plášťa (1) je osadená pevne teplovýmenná plocha (9) so vstupným hrdlom (10) chladiacej vody, s výstupným hrdlom (11) chladiacej vody a s uložením (12), pričom v dolnej časti plášťa (1) je uporiadaná odplyňovacia časť (7) so vstupným hrdlom (8) neodplynenej vody.

Integrálny expandér so zmiešavacím výmenníkom

Načítavanie...

Číslo patentu: 284650

Dátum: 18.07.2005

Autor: Liko Ľudovít

MPK: F24D 19/08, F28B 9/00, F24D 3/04...

Značky: integrálny, expandér, výmenníkom, zmiešavacím

Zhrnutie / Anotácia:

V parnom priestore zariadenia v hornej časti plášťa (1) je osadený pevne dezintegrátor (9) so vstupným hrdlom (10) chladiacej vody a s uložením (11), pričom dezintegrátor (9) má tvar mreže alebo dýzy, a v dolnej časti plášťa (1) je usporiadaná expanzná časť (7) so vstupným hrdlom (8) tlakovej vody.

Deriváty kyseliny antranilovej ako modulátory rezistencie proti mnohým liekom, spôsob ich prípravy, ich použitie a farmaceutický alebo veterinárny prípravok s ich obsahom

Načítavanie...

Číslo patentu: 284649

Dátum: 18.07.2005

Autori: Sanderson Jason Terry, Folkes Adrian John, Ashworth Philip Anthony, Maximen Levi Michael, Hunjan Sukhjit, Roe Michael Bryan, Ryder Hamish, Williams Susannah, Brumwell Julie Elizabeth

MPK: C07D 217/04, A61K 31/47

Značky: farmaceutický, rezistencie, mnohým, antranilovej, obsahom, proti, deriváty, kyseliny, přípravy, liekom, spôsob, prípravok, použitie, veterinárny, modulátory

Zhrnutie / Anotácia:

Sú opísané deriváty kyseliny antranilovej ako modulátory rezistencie proti mnohým liekom všeobecného vzorca (I) a ich farmaceuticky prijateľné soli, kde každé z R až R9 sú organické substituenty, n je 0 alebo 1, m je 0 alebo celé číslo od 1 do 6, q je 0 alebo 1, X je priama väzba, O, S, -CH2-(CH2)p- alebo -O-(CH2)p-, kde p je celé číslo od 1 do 6 a Ar je nenasýtená karbocyklická alebo heterocyklická skupina, ktoré sú aktívne ako inhibítory...

Antivírusové zlúčeniny

Načítavanie...

Číslo patentu: E 10186

Dátum: 18.07.2005

Autori: Sheng Xiaoning, Mcmurtrie Darren, Chaudhary Kleem, Fleury Melissa, Kim Choung

MPK: A61K 31/662, A61P 31/12, C07D 207/08...

Značky: antivírusové, zlúčeniny

Text:

...vo W 0 02/060926, W 0 03/064416,WO 03/064455, WO 98/17679, WO 03/064456, W 0 03/066103, W 0 03/ 099316,WO O 3/ 053349, W 0 00/ 59929, W 0 02/ 060926, US 2004/ 048802, US 2003/186895, US 2003/224977, US 6,608,027,WO 03/099274,WO 00/09543 a WO 99/07733. V publikácii Bioorganic Medicinal Chemistry Letters (2003) 13 2745 2748 sa uvádzajú fenetylamidové dipeptidové inhibítory HCV NS 3 proteázy.Vnútrobunkové zacielenie možno dosiahnuť metódami a...

Epoxidové živice so zlepšenou elasticitou

Načítavanie...

Číslo patentu: E 8563

Dátum: 18.07.2005

Autori: Lunzer Florian, Grasböck Rosemaria, Reisinger Sandra, Fischer Thomas

MPK: C08G 59/18

Značky: zlepšenou, epoxidové, živice, elasticitou

Text:

...dveepoxidove skupiny v jednej molekule a ktorá vykazuje obsah epoxidových skupinpohybujúci sa v rozmedzí od 0,5 mol/kg do 10 mol/kg, kde sa pomer počtu hydroxylových skupín v C 1 voči počtu hydroxylových skupin v C 2 pohybuje v rozmedzí od 1 0,85 do 1 7.0009 Vynález sa ďalej týka spôsobu prípravy epoxidových živic AB so zlepšenou elasticitou zahŕňajúceho reakciu alifatického polyéteru B 1 nesúceho hydroxylové funkčné skupiny s...

PEF-TS expresívne jednotky v CORYNEBACTERIUM GLUTAMICUM

Načítavanie...

Číslo patentu: E 10792

Dátum: 16.07.2005

Autori: Klopprogge Corinna, Schröder Hartwig, Kröger Burkhard, Zelder Oskar, Haefner Stefan

MPK: C07K 14/34, C12Q 1/68

Značky: corynebacterium, glutamicum, pef-ts, jednotky, expresívne

Text:

...počas rastu znefunkčnia expresiu génu,ale po optimálnom raste ju sfunkčnia, využiť na reguláciu génu, ktorý kontroluje produkciu metabolitov. Pozmenený kmeň vykazuje potom rovnaké parametre rastu ako východiskový kmeň, na jednu bunku ale produkuje viac produktu. Tento typ modifikácie môže zvýšiť titer (g produktu/liter) ako aj C-výtažok (g produktu/g-C zdroja).V druhu Corynebacterium bolo možné už izolovať také nukleotidové sekvencie, ktoré...

Laserový pásový zvárací stroj a spôsob zvárania pásu

Načítavanie...

Číslo patentu: E 8920

Dátum: 16.07.2005

Autori: Neumann Manfred, Jungeblodt Clemens

MPK: B23K 26/26, B23K 26/38, B21B 15/00...

Značky: laserový, pásový, pásu, spôsob, zvárania, zvárací, stroj

Text:

...rozdelenie lúča na kon coch pásov.0013 Na rezanie nábežných, resp. výstupných koncov pásov po zvedeni vopred prirezaných koncov pásov do prostriedku je možné do stredovej polohy vykývnut aj zváraciu optiku.Pripadne potrebné zmeny ohniskovej vzdialenosti sa vykonajú špeciálnymi zaostrovacímísystémami. Optické vlastnosti laserového lúča sa udržiavajú nezmenené v dôsledku výkyvulaserovej hlavice po rovnakom polomere vzhľadom na stred výkyvu.0014...

Pripájací a spojovací modul, najmä pre vykurovacie zariadenia

Načítavanie...

Číslo patentu: E 18835

Dátum: 15.07.2005

Autori: Peters Bernard, Spahn Hans-josef, Saunus Christian, Ruf Andreas, Braun Thomas, Salg Frank, Laubmann Gerhard, Hiegemann Markus

MPK: F24H 9/14, F24H 9/12

Značky: modul, najmä, spojovací, pripájací, zariadenia, vykurovacie

Text:

...žliabok. Po spojení oboch dielov modulu sa teda vnútripripájacieho a spojovacieho modulu vytvorí kruhová trubica.-3 0011 Podľa znakov závislého nároku 3 sú pripájacie hrdlá na pripojeniesúčastí, ktoré vedú fluidum, integrovanou súčasťou dielov modulu.0012 Podľa znakov závislého nároku 4 pozostáva pripájací a spojovací modul prevažne z dráh prúdenia, pripájacích hrdiel a vystužovacích rebier. To má za následok, že sa hromadeníe materiálu...

Spôsob rekuperácie tepla

Načítavanie...

Číslo patentu: E 18106

Dátum: 15.07.2005

Autori: Nass Erling, Moxnes Bjorn Petter, Sonju Otto Kristian, Slungaard Torbjorn

MPK: F28F 1/02, F27D 17/00, C25C 3/22...

Značky: tepla, rekuperácie, spôsob

Text:

...na čistenie plynov.0015 Tento vynález sa môže používať v súlade s neskôr uvedeným technickým riešením, ktoré bude najekonomickejšie, pretože teplo odstránené zo surového plynu sa môže použiť viných procesoch alebo aplikáclách.0016 Vtomto dokumente sa uvádza príklad tohto spôsobu na prevádzke na výrobu hlinlka a je charakterizovaný tým, že veľké množstvo plynného exhalátu (rádovo 5000 Nm°lh na výrobnú jednotku hliníka), ktorý obsahuje...

HER2 protilátková kompozícia

Načítavanie...

Číslo patentu: E 17519

Dátum: 15.07.2005

Autori: Kao Yung-hsiang, Vanderlaan Martin

MPK: C07K 16/32, A61K 39/395

Značky: protilátková, kompozícia

Text:

...Production (Február 2002) opisuje VHS predĺženie na ťažkom retazci E 25. humanizovanej anti-lgE protilátky.0017 Rouse a spol. Poster prezentovaný na WCBP Top Down Glycoprotein Characterization by High Resolution Mass Spectrometry and lts Application to Biopharmaceutical Development (6-9. január 2004) opisuje monoklonálnu protilátkovú kompoziciu s N-koncovou heterogenitou poskytovanou 3 AHS alebo ZHS signálnymi peptidovými zvyškami najej...

Obal na nosiče digitálneho záznamu v tvare disku

Načítavanie...

Číslo patentu: E 3797

Dátum: 15.07.2005

Autor: Crouan Alain

MPK: G11B 33/04

Značky: nosiče, disků, záznamu, tvare, digitálneho

Text:

...tvorenýmí aspoň dvomi radiálnymi osadeniami určenými na to, aby v pokojovej polohe prekrývali okrajovú oblast disku, pričom aspoň jedno z týchto radiálnych osadení je pohyblivé medzi pokojovou polohou, v ktorej prekrýva okrajovú oblast disku a uvoľňovacou polohou, ked toto osadenie uvoľňuje predmetnú okrajovú oblasť, charakterizovaného tým, že totopohyblivé blokovacie osadenie má vysúvacie tlačidlo nesené dvoma pozdĺžnymi lamelami...

Rolovaný trávnik bez zeminy a spôsob jeho výroby

Načítavanie...

Číslo patentu: 284647

Dátum: 15.07.2005

Autor: Augsberger Walter

MPK: A01G 1/00, A01G 31/00

Značky: spôsob, rolovaný, trávnik, výroby, zeminy

Zhrnutie / Anotácia:

Rolovaný trávnik bez zeminy má hmotnosť maximálne 9 kg/m2, najmä maximálne 6 kg/m2, a ako substrát obsahuje rozdrobenú slamu a/alebo rozdrobené repkové byle, kukuričné byle a/alebo slnečnicové byle. Pri výrobe rolovaného trávnika sa slama, repkové byle, kukuričné byle a/alebo slnečnicové byle rozdrobia na sečku a zmiešajú s až 50 % hmotn., najmä 30 % hmotn., pilín, vzhľadom na celkovú hmotnosť, a takto vzniknutý substrát sa nanesie na humusovú...

Bicyklická aromatická aminokyselina, spôsob jej prípravy, jej použitie a farmaceutický prostriedok, ktorý ju obsahuje

Načítavanie...

Číslo patentu: 284646

Dátum: 15.07.2005

Autori: Rippmann Friedrich, Diefenbach Beate, Raddatz Peter, Wiesner Matthias, März Joachim, Goodman Simon

MPK: C07D 265/36, A61K 31/535, A61K 31/335...

Značky: prostriedok, přípravy, obsahuje, farmaceutický, spôsob, ktorý, použitie, bicyklická, aromatická, aminokyselina

Zhrnutie / Anotácia:

Opísaná je bicyklická aromatická aminokyselina všeobecného vzorca (I) a jej fyziologicky vhodné soli ako GPIIb/IIa-antagonisty a ako inhibítory alfav-integrínu na výrobu farmaceutických prostriedkov na liečbu napríklad patologických angiogénnych chorôb, trombóz, infarktu srdca, koronárnych ochorení srdca, artériosklerózy, nádorov, osteoporózy, zápalov a infekcií.

Mnohočasticová tableta na báze častíc s potiahnutým aktívnym základom a zmesi nosičov

Načítavanie...

Číslo patentu: 284645

Dátum: 15.07.2005

Autori: Zuccarelli Jean-marc, Barbero Maryvonne, Nouri Nourredine, Chauveau Charles

MPK: A61K 9/20, A61K 9/00

Značky: základom, nosičov, zmesí, báze, tableta, aktívnym, mnohočasticová, potiahnutým, částic

Zhrnutie / Anotácia:

Zlepšená mnohočasticová tableta, ktorá sa rozloží v ústach v styku so slinou za menej než 40 sekúnd, je založená na báze častíc s potiahnutým aktívnym základom a obsahuje rozkladajúce činidlo, zrieďujúce rozpustné činidlo so spájajúcimi vlastnosťami, mastivo, prepúšťajúce činidlo a výhodne sladidlá, vonné látky a farbivá.

Kladivový drvič

Načítavanie...

Číslo patentu: 284644

Dátum: 15.07.2005

Autor: Mecklenfeld Hermann

MPK: B02C 13/28

Značky: kladivový, drvič

Zhrnutie / Anotácia:

Kladivový drvič, ktorého aspoň jeden rotor (1) je vytvorený najmenej jedným rúbacím diskom (2) s kladivami (3) inštalovanými rovnomerne po jeho obvode, má každé kladivo (3) voľne otočné vnútri priestoru (5) kmitania okolo prídržného čapu (4). Pritom na každom rúbacom disku (2) je inštalovaných päť kladív (3), - rozdiel medzi priemerom (DR) rotora (1) a priemerom (DS) rúbacieho disku (2) - a tým presah kladiva (HU) je zvolený čo najväčší a -...

Tepelnoizolačná nádoba s elektrickým ohrevom

Načítavanie...

Číslo patentu: 284643

Dátum: 15.07.2005

Autori: Nakagawa Hiroyuki, Kuwabara Hideo, Tomita Hideyuki, Sano Minoru

MPK: A47J 41/00

Značky: ohrevom, nádoba, tepelnoizolačná, elektrickým

Zhrnutie / Anotácia:

Tepelnoizolačná nádoba s elektrickým ohrevom obsahujúca zásobník (1), ktorý je tvorený skleneným vákuovým dvojstenovým vnútorným a vonkajším zásobníkom (1a, 1b) umiestneným v kryte (3), ktorý obklopuje zásobník (1), veko (4), ktoré uzatvára horný otvor (3a) krytu (3) a ohrievač (2) umiestnený v zásobníku (1), ďalej obsahuje riadiaci substrát (11) na reguláciu výstupu ohrievača (2) a detektor (10) úrovne vodnej hladiny na poskytnutie signálu o...

Deriváty kyseliny 3-aryl-2-hydroxypropiónovej, farmaceutický prípravok s ich obsahom a ich použitie

Načítavanie...

Číslo patentu: 284642

Dátum: 15.07.2005

Autor: Andersson Kjell

MPK: C07C 309/66, A61K 31/19

Značky: použitie, 3-aryl-2-hydroxypropiónovej, obsahom, deriváty, prípravok, kyseliny, farmaceutický

Zhrnutie / Anotácia:

Sú opísané deriváty kyseliny 3-aryl-2-hydroxypropiónovej vzorca (I) a ich farmaceuticky prijateľné soli, solváty a kryštalické formy, spôsob a medziprodukty na ich prípravu, farmaceutické prípravky, ktoré ich obsahujú, a použitie zlúčeniny pri klinických stavoch spojených s inzulínovou rezistenciou.

Zátková tyč na privádzanie plynu do roztaveného kovu

Načítavanie...

Číslo patentu: E 3165

Dátum: 15.07.2005

Autor: Guillo Philippe

MPK: B22D 41/14

Značky: zátková, plynů, roztaveného, privádzanie

Text:

...spojujúci vnútornú komoru s plynovým výstupným otvorom, pričom vnútorná komora a kanálik vymedzujú plynovýV súlade s predmeton tohto vynálezu sú steny plynového priechodu opatrené vrstvou, ktorá nevytvára oxid uhoľnatý priprihlasovateľa je to prvýkrát, kedy bolo navrhnuté opatritžiaruvzdorný výrobok takou vrstvou na časti tohto výrobku, ktorá nikdy nepríde do styku s roztaveným kovom.Naopak podľa známeho stavu techniky, predstavovaného...

Spôsob odstraňovania vtrúsenín v zvare a zariadenie na vykonávanie spôsobu

Načítavanie...

Číslo patentu: E 3040

Dátum: 15.07.2005

Autor: Helmig Egbert

MPK: B23K 9/16

Značky: spôsob, spôsobu, vykonávanie, zariadenie, zvare, odstraňovania, vtrúsenín

Text:

...1, ako izariadením podľa nároku 12.0017 Ako sa prekvapivo ukázalo, sú pri opracovaní zvaru. uskutočňovanom v tomto zmysle, uvoľňované vtrúseniny, predovšetkým silikáty prítomné v povrchovej oblasti, pričom najmenej jeden prúd tekutého média, s výhodou vodný lúč, atakuje vtrúseniny v hraničnej oblasti k priľahlému materiálu a0018 Pritom je médium pod tlakom 1500 až 4000 barov, s výhodou 2500 až 3000 barov.0019 Keďže jednotlivé vtrúseniny...

Spôsob účinného podávania liečiv a spôsob prevencie vedľajšieho účinku

Načítavanie...

Číslo patentu: E 9425

Dátum: 15.07.2005

Autori: Kudou Shinji, Yasue Tokutarou, Kuriyama Kazuhiko

MPK: A61K 31/145, A61K 31/519, A61K 31/436...

Značky: spôsob, vedľajšieho, liečiv, podávania, prevencie, účinků, účinného

Text:

...dokument 4 Transplantation, 53 303 (1992).Problém, ktorý má byt riešený vynálezom0007 Predmetom predkladaného vynálezu je poskytnúť spôsob účinného vyvolania účinku imunosupresívneho činidla alebo protízápalového činidla, t.j. imunosupresívnej aktivity alebo protizápalovej aktivity v maximálnom stupni,zatiaľ čo sa redukuje vedľajší účinok imunosupresívneho činidla alebo protízápalového činidla kombinovaným použitím imunosupresívneho...

Tepelný článok pre vykurovacie teleso

Načítavanie...

Číslo patentu: E 19859

Dátum: 15.07.2005

Autori: Bremicker Michael, Söhnchen Frank, Bornscheuer Walter

MPK: F28D 9/00, F24H 1/32

Značky: tepelný, vykurovacie, článok, těleso

Text:

...znakov závislého nároku 7 sa zužuje štrbina V aby to bolo primerané pre ochladenie splodín. To je znázornené na vyobrazení 6.Vynález bude podrobne vysvetlený na základe vyobrazení.obrázok 1 rez tepelným článkom podľa vynálezu, obrázok 2 platňa primárneho tepelného výmenníka v pohľade zhora, obrázok 3 rez primárnym tepelným výmenníkom, obrázok 4 tepelný článok V inom reze, obrázok 5 alternatívny spôsob uskutočnenia tepelného výmennika podľa...

Priehradová konštrukcia ako aj prúty pre priehradovú konštrukciu

Načítavanie...

Číslo patentu: E 7706

Dátum: 15.07.2005

Autor: Lipp-bühler Peter

MPK: F16B 7/00

Značky: konštrukciu, priehradovú, konštrukcia, prúty, priehradová

Text:

...zariadení.0011 Prúty sú v priečnom reze profily tvaru Iso stenou a dvoma pásnicami. Také prúty savyznačujú obzvlášť priaznivými statickými vlastnosťami.0012 Priehradová konštrukcia sa v podstate skladá z vertikálne prebiehajúcich podpier a horizontálne prebiehajúcich nosníkov. Pri prútoch pre nosníky prebieha dosadacia plocha pre spojovací dielec pravouhlo na pozdĺžny smer prúta. Tým sa tieto prúty dajú čelne navzájom spojiť...

Oxazolové deriváty ako činidlá histamínových H3 receptorov, ich príprava a terapeutické použitie

Načítavanie...

Číslo patentu: E 6000

Dátum: 14.07.2005

Autori: Jesudason Cynthia Darshini, Beavers Lisa Selsam, Boulet Serge Louis, Vaught Grant Matthews, Stevens Freddie Craig, Pickard Richard Todd, Finn Terry Patrick, Gadski Robert Alan, Hornback William Joseph

MPK: C07D 263/00, A61P 25/00, A61K 31/422...

Značky: príprava, histamínových, deriváty, činidla, receptorov, terapeutické, použitie, oxazolové

Text:

...zmenila biológiu histamínu a musí byt uvažovaná pri vývoji0005 Boli vytvorené niektoré antagonisty histamínového H 3 receptora, ktoré napodobňujú histamín tým, že. obsahujú imidazolový kruh všeobecne substituovaný v polohe 4(5) (Ganellin a kol., Ars Pharmaceutica, 1995, 363,455-468). Rad patentov a patentových prihlášok, týkajúcich sa antagonistov a agonistov s touto štruktúrou zahŕňajúcich EP 197840, EP 494010, WO 97/29092, WO 96/38141, a...

Vylepšenie nosných konštrukcií pre cestné reklamné pútače

Načítavanie...

Číslo patentu: E 5841

Dátum: 14.07.2005

Autor: Pietroforte Alberto

MPK: G09F 7/18

Značky: cestné, reklamné, konštrukcií, nosných, vylepšenie, pútače

Text:

...nosná konštrukcia0008 Sú známe pokusy odstrániť nevýhody nosných konštrukcií pre cestné reklamne pútače opisané napriklad V patentových spisoch DE 23 61 484 Al, DE 9 l lD 340 Ul a EP A l 220 185.0009 Jedným 2 predmetov tohto vynálezu je nosná konštrukcia pre cestné reklamné pútaće, kde rám, na ktorom je uložený reklamný pútač, je pripevnený na stĺp prostrednictvom zostavy strmeňov, ktoré sú otočné okolo kĺbových spojov,integrálnych s nosným...

Spôsob výroby vláknitého kompozitu pre výrobu konštrukčných dielov z netkanej textílie

Načítavanie...

Číslo patentu: E 5377

Dátum: 14.07.2005

Autor: Roth Ekkehard

MPK: B29C 70/08, B29C 70/00

Značky: dielov, konštrukčných, textilie, netkanej, spôsob, výroby, výrobu, kompozitů, vláknitého

Text:

...dielov z netkaných textílií docieliť lepšie mechanické a optické vlastnosti(trieda A povrchy) a okrem toho tieto materiály vyrábať rýchlejšie a tým cenovo priaznivejšie než doteraz0007 Prídavkom plnív z vlastných spevňovacích vlákien, napríklad uhlíkových vlákien, sa získa podstatne homogénnejší konštrukčný diel svýhodnejšími vlastnosťami než doteraz. Povrchová plocha dielu je pritom veľmi hladká, čím je možné dosiahnúť povrchovú...

Hydraulický riadiaci systém pre lodné motory

Načítavanie...

Číslo patentu: E 4081

Dátum: 14.07.2005

Autor: Mancini Vincenzo

MPK: B63H 20/00

Značky: motory, systém, hydraulický, riadiaci, lodné

Text:

...62, poskytnuté koaxiálnymi priechodnými dierami 63, schopnými pojat tyč 3. Týmto spôsobom sa stojina 60 môže otáčať okolo vodorovnej priečnej osi deñnovanej tyčou 3 a motor 61 sa môže otáčať okolo zvislej osi, definovanej zvislým otočným čapom motora 61 vzhľadom na stojinu 60.0019 Motor 61 má vpredu tyč 64 votknutú do skrine motora. Na konci prednej tyče motora je vytvorená priechodná diera 65.0020 Na hydraulický valec 5 je namontovaný...

Cigaretová krabička a jej plášť

Načítavanie...

Číslo patentu: E 3791

Dátum: 14.07.2005

Autor: Mazur Wojciech

MPK: B65D 85/08

Značky: plášť, cigaretová, krabička

Text:

...a z výklopného vrchnáka, ktorý je pripojený k spomínanej úložnej časti prostredníctvom klbového spoja, ktorý sa nachádza na zadnej stene. Predná stena vrchnáka je dlhšia ako jeho zadná stena, bočné steny sú skosené. V rámci plochy pozdĺžneho výrezu(plášťa) cigaretovej krabičky sa nachádzajú nasledujúce steny predná, vrchná a spodná stena vrchnáku spripojenými bočnými stenami, zadná stena úložného priestoru s pripojenými bočnými...

Baktericídna kompozícia na použitie v poľnohospodárstve alebo v záhradníctve a spôsob regulácie chorôb rastlín

Načítavanie...

Číslo patentu: E 9210

Dátum: 14.07.2005

Autor: Sugimoto

MPK: A01P 3/00, A01N 47/12, A01N 43/50...

Značky: poľnohospodárstve, chorôb, použitie, baktericídna, spôsob, rastlín, záhradníctve, regulácie, kompozícia

Text:

...pravdepodobne môžu byť infikované patogénnymi hubami, a je vhodná na reguláciu chorôb ako je múčnatka (powdery míldew), pleseň (downy míldew), antraknóza,pleseň šedá, zelená pleseň, chrastavitosť (scab), alternáriová škvmitosť listov (alternaria leaf spot), bakteriálna sneť (bacterial blight), listová sneť (leaf blight), lusková a stonková sneť (pod and stem blight), hníloba zrelých plodov (ripe rot), pleseň zemiaková (late blight),...

Chladenie formy krčku

Načítavanie...

Číslo patentu: E 9007

Dátum: 14.07.2005

Autor: Flynn Robin

MPK: C03B 9/38

Značky: chladenie, formy, krčku

Text:

...komory na chladenie formy krčka a zostavu ventilu tlmiča, ktorá je čiastočne znázornená V priereze, abysa znázornili jednotlivé časti ventilu tlmičaobr. 5 predstavuje neúplný pohľad v priereze na časť zbemej vzduchovej komory na chladenieformy krčka vzduchom znázorňujúci dráhu prúdenia vzduchu cez túto zostavu aobr. 6 predstavuje neúplný perspektívny pohľad v priereze na časť zbemej vzduchovej komoryna chladenie formy krčka.Podrobný...