Archív za 2004 rok

Strana 67

Magnetický snímač prietoku a merač prietoku, ktorý ho zahrnuje


Číslo patentu: E 1462

Dátum: 14.04.2004

Autori: Glauser Antony Robert, Knill Alexander Charles

MPK: G01F 1/56

Značky: zahrnuje, merač, magnetický, prietoku, snímač, ktorý


...iónmi. Ióny striebra sú obzvlášť výhodné, keďže tuhé striebro je stabilné vo vode po dlhú dobu avýznamne nekoroduje. Navyše, je netoxické a je povolenou potravinovou prísadou (E 174). Striebro je tiež blízke medi v elektrochemíckých sériách, znižujúc riziko neželenej elektrolytickej korózie vo vodných trubkách. Je tiež biocídne, pomáha predchádzať usádzaniu a vytváraniu problémových bio-povlakov na elektródach a okolo nich.Navyše, usporiadanie...

Spôsob na zabránenie doručenia nevyžiadanej pošty v službe odosielania krátkych správ


Číslo patentu: E 19536

Dátum: 14.04.2004

Autor: Nooren Eloy Johan Lambertus

MPK: H04W 88/18, H04L 12/58

Značky: službe, doručenia, krátkých, zabránenie, správ, nevyžiadanej, pošty, spôsob, odosielania


...ovládať doručenie správySMS do mobilného terminálu. Je potrebné uznať, že prevod druhých smerovacích údajov na prvé smerovacie údaje by sa mal vykladať extenzívne, t.j. je potrebné len to, aby bolo možné nájsť prvé smerovacie údaje, keď sú prijaté alebo známe druhé smerovacie údaje. Ďalej je potrebné uznať, že výraz sieťový prvok by sa mal vykladať extenzívne, pričom môže zahŕňať niekoľko komponentov alebo aplikácií,cez ktorý je...

Obrusná zostava pre rýpaciu hranu barga


Číslo patentu: E 14698

Dátum: 14.04.2004

Autor: Jones Larren

MPK: E02F 9/28

Značky: hranu, obrusná, zostava, barga, rýpaciu


...12 (obrázky 3 až 5). Telo 2 výhodne zahrnuje pár koľajničiek 24 pokračujúcich pozdĺž bočníc 26 v smere dozadu od prednej hrany 14 c, 16 c. Kolajničky vyčnievajú nabok von z každej bočnice 26,aby vytvorili konfiguráciu tvaru T. Kolajničky 24 majú prídržné povrchy 25, ktoré sú vzdialené od vonkajšieho čela a otočené k vonkajšiemu čelu 14 b, 16 b. Ako sa diskutuje nižšie, koľajničky 24 spolupracujú s obrubným členom alebo (v tomto prípade)...

Balenie s posúvnym viečkom


Číslo patentu: E 7208

Dátum: 13.04.2004

Autori: Grandjean Jean-pierre René, Velloni Alessandro, Pena Javier

MPK: B65D 5/64, B65D 85/08, B65D 5/00...

Značky: balenie, viečkom, posuvným


...stena dna v podstate obdĺžniková (alebo štvorcová) - na pripojenie takýchto stien dna s jednou, dvoma, tromi alebo štyrmi zaoblenými rohmi sú potrebné maximálne štyri stien kontajnera, menovite čelná stena, zadná stena a dve bočné steny. Hrany medzi týmito stenami môžu byť prípadne zaoblené alebo skosené. Avšak jedna alebo viac stien môže chýbať a/alebo môžu byť zmenšené. Napriklad čelná stena môže chýbať alebo môže byť zmenšená a/alebo...

Bezkontaktný nosič dát


Číslo patentu: E 5992

Dátum: 13.04.2004

Autori: Rossmadl Alfred, Graf Hans, Finkenzeller Klaus

MPK: G06K 7/00, G06K 19/14, G06K 19/077...

Značky: nosič, bezkontaktný

Text: číta opticky čitateľný prvý identifikačný prvok a bezkontaktne čitateľný druhý identifikačný prvok a ich identifikačné informácie sa kontrolujú na zhodu (pozripredvýznakové časti nezávislých nárokov). Ako náhle dôjde kzhode, je predmet, označený identifikačnými prvkami, identifikovaný ako správny a uznaný za autentický. Pritom jedruhý identifikačný prvok vytvorený ako elektronicky čitateľnýidentifikačný prvok a umiestnený na...

Spôsob prípravy dialkyl-3-oxoglutarátov


Číslo patentu: E 5230

Dátum: 13.04.2004

Autori: Jákfalvi Elemér, Gregorné Boros Livia, Szabo Attila, Olah Sándor, Morasz Tamás, Töreki József, Tóth Gábor

MPK: C07C 67/00, C07C 69/00

Značky: přípravy, spôsob, dialkyl-3-oxoglutarátov


...ktorá sa uskutoční s použitím zriedenej kyseliny chlorovodíkovej.0010 Nevýhoda vyššie uvedených dvoch metód spočíva v tom, že sa pri nich používajúureakčné činidlá a sú vyžadované reakčné teploty (reakcia s lítiumdiizoipropylamidom sa uskutočňuje pri teplote -45 °C, a na druhej strane použitie amidu sodného a kvapalného amoniaku), ktoré vyžadujú zvláštne zaobchádzanie nevhodné pre výrobu v priemyselnom meradle (ako je napríklad dokonalá...

Výpustný uzáver


Číslo patentu: E 4348

Dátum: 13.04.2004

Autor: Lindmayer István

MPK: B65D 47/04

Značky: uzáver, výpustný


...časť poskytuje dovnútra twrientovantr obrubu elastický trloženťr z onkajsej strany na hrdlelTaše a tcsniaci výčneltrlç otvziurjťrci ústie lľase a elastický Lrloženy x. vnútra k nemu.Výpustný uzáver napísaný v prihláške má výhodne charakteristické znaky.montážna čast poskytuje stúpajúci orientovaný kŕčok na jeho okraji sedia v drážke tvorenej stenou viečka a paralelne zostupne ttsmerneny vnútornou stenou.Výpustný uzáver opísaný v prihláške...

Spôsob prípravy N-terminálom modifikovaných chemotaktických faktorov


Číslo patentu: E 3895

Dátum: 13.04.2004

Autori: Doods Henri, Necina Roman, Lenter Martin, Wandl Robert, Seidler Randolph

MPK: A61K 38/19, C07K 14/435, A61P 9/00...

Značky: faktorov, chemotaktických, přípravy, n-terminálom, spôsob, modifikovaných


...MCP-l proteínu izolovaného zprírodného zdroja je N-koniec blokovaný. Ako sa zístilo neskôr, toto naznačuje na posttranslačnú modiñkáciu, pri ktorej sa glutmnín, uvoľnený po odštiepenícagttcaatg atttgaatga cttcctggct atgctttcatccccatcctc tcacccccct cagatttaac ctćtccccct gagaccaacc aaagtctctg Ctcgctcagc gttatcatgg caagataagg gcagagcctg atccagctct gatcagggta cagaatctgg tgagtatcag gtggggctcc gacacttgta ttatataccc ctctgaggta ttttgttttt...

N-[(piperazinyl)hetaryl]arylsulfónamidové zlúčeniny s afinitou k dopamínovému D3 receptoru


Číslo patentu: E 3633

Dátum: 13.04.2004

Autori: Sauer Daryl, Drescher Karla, Braje Wilfried, Haupt Andreas, Lubisch Wilfried, Geneste Hervé, Grandel Roland, Unger Liliane, Turner Sean

MPK: A61K 31/44, A61P 13/00, A61K 31/505...

Značky: n-[(piperazinyl)hetaryl]arylsulfónamidové, zlúčeniny, afinitou, dopamínovému, receptoru


...fenyl alebo benzyl aR 6, R 7 sú každý nezávisle vybraný z Cl-C 4-alkylu, Cg-Cphalogénalkylu alebo spoločne s dusíkom, ku ktorému sú viazané, vytvárajú nasýtený 3-, 4-, 5- alebo 6-členný heterocyklus,ktorý navyše môže zahŕňať atóm kyslíka alebo ďalší atóm dusíka v kruhu, a ktorý môže niesť l,2, 3 alebo 4 Cl-Cą alkylové skupinyich N-oxidy a fyziologicky prijateľné adičné soli týchto zlúčenín s kyselinou.0009 Tieto zlúčeniny...

Spôsob prípravy 4,10beta-diacetoxy-2alfa-benzoyloxy-5beta,20-epoxy-1,13alfa-dihydroxy- 9-oxo-19-norcyklopropa[g]tax-11-enu


Číslo patentu: E 3454

Dátum: 13.04.2004

Autori: Didier Eric, Amouret Guy

MPK: C07D 305/00

Značky: přípravy, spôsob, 9-oxo-19-norcyklopropa[g]tax-11-enu, 4,10beta-diacetoxy-2alfa-benzoyloxy-5beta,20-epoxy-1,13alfa-dihydroxy


...vyššie uvedených troch patentoch je zlepšený použitím sulfolánu.0011 Zlúčenina nasledujúceho vzorca (I)Ar znamená radikál aryl, R znamená atóm vodíka alebo acetylový, alkoxyacetylový alebo alkylový radikál, R 1 znamená benzoylový radikál alebo radikál R 2-O-CO-, v ktorom R 2 znamená priamyalebo rozvetvený alkylový radikál obsahujúci 1 až 8 atómov uhlíka, sa pripraví spôsobomspočívajúcom v uvedení zlúčeniny vzorca (II)V ktorom R znamená...

Spôsob zhodnotenia ťažkých surovín odasfaltovaním a hydrokrakovaním na ebulovanom lôžku


Číslo patentu: E 3266

Dátum: 13.04.2004

Autori: Gueret Christophe, Verstraete Jan, Kressmann Stéphane

MPK: C10G 69/00

Značky: hydrokrakováním, surovin, zhodnotenia, odasfaltovaním, spôsob, ťažkých, lôžku, ebulovanom


...spracovanie alebo vyžadujúce iba mierne dodatočné spracovanie.0010 Tento vynález sa teda zameriava na spôsob spracovania suroviny uhľovodíkov, z ktorých minimálne 95 hmotn. sú tvorené zlúčeninami, ktoré majú teplotu varu aspoň 340 C, ktorý je charakteristický tým, že obsahujea) sa spája surovina srozpúšťadlom tak, aby sa získal odasfaltovaný nástrek, ktorý má obsah asfalténov (nerozpustných v n-heptáne podla normy NF-T-60-115) nižší ako...

Spôsob a forma na výrobu ozubených remeňov na prenos sily


Číslo patentu: E 2733

Dátum: 13.04.2004

Autori: Song Tao, Wegele Brian Dean, Lederer Steven Andrew

MPK: F16G 5/00, B29D 29/00

Značky: ozubených, prenos, spôsob, výrobu, forma, remeňov


...meniť na základe obvodovej dĺžky remeňa Až doposiaľ bola na výrobu remeňa danej obvodovej dĺžky požadovaná špecifická, jednoúčelová fonna, umožňujúca potrebný optimalizovaný sled rozstupov. Pretože vytvorenie špecifickej formy prekaždú dĺžku remeňa je cenovo nedostupné, bola priemyselná prax pomalé pri prijímaní techník na znižovanie hluku vdezéne a sledu zubov vremeňoch rôznych dĺžok. Kým sa táto prax nevyvaruje nákladného rozširovania...

Otočné alebo natáčacie zariadenie a pripojovací modul na otočné alebo natáčacie zariadenie


Číslo patentu: E 1602

Dátum: 13.04.2004

Autor: Hoch Andreas

MPK: F15B 15/00

Značky: připojovací, modul, natáčacie, zariadenie, otočné


...puzdra umiestnených blokovacích uložení, a tým nepriamo alebo bezprostredne do puzdra. Následne sa zaistíPodľa vynálezu môže byť ďalej také usporiadanie, že blokovací piest má uloženie pre blokovacie prostriedky a na uloženie sa napájajúce vodiace skosenie na nútené vedenie blokovacích prostriedkov pri dosiahnutí blokovacej polohy. Cez definované vodiace skosenie sa blokovacie prostriedky nútene vedú radiálne smerom von do zo strany puzdra...

Povlak na báze vody s vysokou odolnosťou proti abrázii


Číslo patentu: E 1105

Dátum: 13.04.2004

Autori: Rahim Marufur, Pinter Michael

MPK: C09D 183/04, C09D 5/02, C04B 35/63...

Značky: proti, abrázii, vysokou, odolnosťou, báze, povlak


...prípadne pridanými zložkami.Povlak ktorý má vysokú odolnost proti abrázii sa získa kom bináciou nitridu bóru a silikónovej živice. Nitrid bóru je vo forme bieleho prášku ktorý má špecifickú hmotnost v rozsahu 1,5 a 2,5 a teplotu topenia asi 3500 F. Nitrid bóru je výhodne vo forme kockovej alebo hexagonálnej kryštalickej štruktúry. Najvýhodnejšie je nitrid bóru vo forme hexagonálnej kryštalickej štruktúry. Veľkost častíc nitridu bóru je...

Kompozícia vodného tekutého koncentrátu pendimetalínu


Číslo patentu: E 7974

Dátum: 13.04.2004

Autor: Goldsmith Andrew

MPK: A01N 25/30, A01N 33/18, A01N 25/28...

Značky: koncentrátů, pendimetalínu, tekutého, vodného, kompozícia


...sú voľne tečúce kompozície, kde sú mikroenkapsulované častice pendimetalínu a nezapuzdrené častice pendimetalínu voľne dispergované vo vodnom suspenznom prostredí. Tieto kompozície ostávajú stabilné celé mesiace pri teplotách presahujúcích 35 C a dokonca aj pri teplotách presahujúcích 45 °C. Navyše tieto kompozície nevykazujú spomalené uvoľňovanieKompozície podľa vynálezu obyčajne obsahujú pendimetalín v celkovej koncentrácii 200 až 600...

Fasáda alebo strecha s niekoľkými úrovňami odvodňovania


Číslo patentu: E 11225

Dátum: 10.04.2004

Autori: Frank Hermann, Schubert Frank

MPK: E04D 3/08, E06B 7/14, E04B 2/96...

Značky: fasáda, odvodňovania, úrovňami, niekoľkými, střecha


...priečniku cez šírku drážky smerom k vonkajšej strane.0014 Odtoková zásterka je účelne nalisovaná na tesnenie pre odtokový priečnik. Vhodné miesto pre tento účel je obzvlášť stredová oblasť tesnenia.0015 Výhodný spôsob uskutočnenia predloženého vynálezu je bližšie vysvetlený nazáklade nižšie sa nachádzajúcich obrázkov. ZobrazujúObr. 1 veľmi zjednodušene schematicke znázomenie fasádneho úseku podľa vynálezu prirealizácii štyroch...

Spôsob kryštalizácie guanidínových solí


Číslo patentu: E 4318

Dátum: 10.04.2004

Autori: Lippert Ricky, Kirschbaum Michael, Haas Alexander, Bartmann Ekkehard, Bensinger Dieter

MPK: C07C 279/00, C07C 315/00, C07C 277/00...

Značky: guanidinových, kryštalizácie, solí, spôsob


...ktoré sú vhodné zvlášť na liečeniearytmií, ku ktorým dochádza v dôsledku nedostatku kyslíka.0004 Tieto zlúčeniny vykazujú dobrý kardioprotektívny účinok a sú vhodné predovšetkým na liečbu akútneho infarktu myokardu, profylaxie infarktu, poinfarktovej liečbe, liečbe srdcovej insuficiencie a angíny pektoris. Ďalej pôsobia proti všetkým patologickým hypoxickým a ischemickým poškodeniam,takže môžu byt liečené primárne alebo sekundárne...

Zlúčeniny kyseliny 1, 2, 4-oxadiazolbenzoovej a ich použitie pre nonsense supresiu a liečenie ochorenia


Číslo patentu: E 18121

Dátum: 09.04.2004

Autori: Chen Guangming, Hwang Seongwoo, Karp Gary Mitchell, Moon Young-choon, Almstead Neil Gregory

MPK: A61K 31/4245, A61P 35/00, C07D 271/06...

Značky: kyseliny, supresiu, ochorenia, liečenie, použitie, 4-oxadiazolbenzoovej, nonsense, zlúčeniny


...aminoglykozidových antibiotík podporovať prečítanieeukaryotických stop kodónov vyvolala záujem o tieto liečivá ako potenciálneterapeutické látky pre ľudské ochorenia spôsobené nonsense mutáciami. Jedným ochorením, pre ktoré môže byť táto terapeutická stratégia životaschopná, je klasická neskorá infantilná neuronálna ceroidná Iipofuscinóza (LINCL), fatálne neurodegeneratívne ochorenie u detí v súčasnej dobe s neexistujúcou liečbou. Mutácie...

Mutagenetická alterácia väzbových afinít k receptoru FcRn alebo sérových polčasov protilátok


Číslo patentu: E 13060

Dátum: 09.04.2004

Autori: Hinton Paul, Tsurushita Naoya, Tso Yun, Vasquez Maximiliano

MPK: C07K 16/00, C07K 16/24, C07K 16/28...

Značky: polčasov, afinít, sérových, väzbových, receptoru, mutagenetická, alterácia, protilátok


...lgG sú vstrebané endotelovými bunkami prostrednictvom nešpeciñckej pinocytózy a potom vstupujú do kyslých endozómov. Receptor FcRn viaže IgG pri kyslom pH (6,5) vendozómoch a uvoľňuje IgG pri bázickom pH ( 7,4) v krvnom riečisku. To znamená, že receptor FcRn chráni lgG pred účinkom Iyzozomálnej degradačnej cesty. Pokial hladiny lgG v sére klesajú, je pre naviazanie IgG kdispozícii viac molekúl receptora FcRn, takže je zachránené...

Aerosolizačný aparát s ochranou pred prívodom vzduchu


Číslo patentu: E 11846

Dátum: 09.04.2004

Autori: Dunkley Michael John, Shirgaonkar Sameer, Tuckwell Jonathan David

MPK: A61M 15/00

Značky: aerosolizačný, vzduchu, aparát, ochranou, prívodom


...tieto vzduchovénasávacie otvory sú zakryté krycím členom.0007 V inom aspekte Vynálezu ručný aerosolizačný aparát obsahuje puzdro ohraničujúce komoru s množstvom vzduchových nasávacich otvorov. Táto komora má veľkosť, ktorá pojmenádobku, ktorá obsahuje aerosolizovateľný farmaceutickýpreparát kryt, ktorý zakrýva minimálne jeden, ale nie všetky vzduchové nasávacie otvory, čím predchádza blokácii minimálne jedného vzduchového nasávacieho otvoru...

Antagonisti receptora CGRP


Číslo patentu: E 4976

Dátum: 09.04.2004

Autori: Deng Zhengwu, Burgey Christopher, Nguyen Diem, Williams Theresa, Paone Daniel, Shaw Anthony

MPK: C07D 471/00, A61P 25/00, A61K 31/4164...

Značky: antagonisti, receptora


...meningeálnej tepny sprostredkovaná CGRP senzitizuje neuróny v nucleus caudalis nervi trigernini (Williamson et al., The CGRP Family Calcitonin Gene-Related Peptide (CGRP), Amylin, and Adrenomedullin, Landes Bioscience, 2000, 245-247). Podobne distenzia cév v dura mater pri migrénovej bolesti hlavy môže senzitizovat neuróny trigemínu. Niektoré zo symptómov združených s migrénou, ako je extrakraniálna bolest a faciálna alodýnia, môžu byť...

Spôsob glykopegylácie a proteíny/peptidy tvorené týmito spôsobmi


Číslo patentu: E 10747

Dátum: 09.04.2004

Autori: De Frees Shawn, Bayer Robert, Zopf David, Chen Xi, Hakes David, Bowe Caryn

MPK: A01N 43/04

Značky: týmito, spôsobmi, glykopegylácie, tvorené, spôsob

Text: prirodzene sa vyskytujúcej forme peptidu. Väčšina peptidov tvorených rekombinantnýmiprostriedkami obsahuje glykánové štruktúry, ktoré sú odlišné od prirodzene sa vyskytujúcich glykánov.0006 Vodbore bol navrhnutý celý rad metód pre prispôsobenie glykozylačného proñlu peptidu vrátane tých opísaných vo W 0 99/22764, W 0 98/58964, W 0 99/54342 a patentu Spojených štátov č. 5 047 335, okrem iných. V podstate bolo klonovaných a...

2,4,6-tris(dineopentyl-4´ -amino-benzalmalonát)-s-triazín, prostriedok na ochranu pred slnečným žiarením s jeho obsahom a jeho použitie


Číslo patentu: E 2402

Dátum: 09.04.2004

Autor: Richard Hervé

MPK: A61Q 17/04, C07D 251/00, C08K 5/00...

Značky: prostriedok, ochranu, slnečným, žiarením, použitie, 2,4,6-tris(dineopentyl-4´, amino-benzalmalonát)-s-triazín, obsahom


...rozpustnosť V mastných látkach, vylepšenúVynález sa týka derivátov s-triazinu nesúcich 3 jednotlivé paraamino-benzalmalonátové skupiny so vzorcom (1), ktorý detailnevynález sa tiež týka kozmetického alebo dermatologického prostriedku obsahujúceho V kozmeticky prijateľnom prostredí aspoň zlúčeninu. so vzorcom (1) a určeného na ochranu látok 2keratínu pred slnečným žiarením.Ďalšie predmety budú objasnené ďalej V opise.Zlúčeniny podľa...

Kryt na elektrický rozvádzač


Číslo patentu: E 9279

Dátum: 09.04.2004

Autor: Passera Constantino

MPK: H02B 1/06

Značky: rozvádzač, elektricky


...panelu, t.j.valcovitú časť s pozdĺžnou osou, ktorá prečnieva paralelne Vočikratším stranám, a priehlbinu 16 (Obrázok 3) s dierou naspodku,ktorá, ak je upínacia doštička pripevnená na mieste, je zarovno s dierou 17 V paneli. Upínacie doštičky 13 môžu byť vyrobené z kovu alebo pevného plastového materiálu. Panel 10 má taký tvar, ktorý obsahuje žliabky 18 pozdĺž minimálne dvoch protiľahlých okrajov každej upínacej doštičky 13. V tomto príklade...

Aerosolizačné zariadenie s vyrovnávacím vodičom na prepichnutie kapsule


Číslo patentu: E 20400

Dátum: 09.04.2004

Autori: Dunkley Michael John, Tuckwell Jonathan David, Paboojian Steve, Glusker Mark, Vernon-harcourt Edward William

MPK: A61M 15/00

Značky: vyrovnávacím, vodičom, aerosolizačné, zariadenie, prepichnutie, kapsule

Text: zošikmená pod uhlom, ktorý je menší ako 55 stupňov vzhľadom na pozdlžnu os kapsuly a koncovú sekciu, ktorá je združená s krytom,pričom koncová sekcia má také rozmery a taký tvar, aby bola prijatá v ústach alebo nose užívateľa tak, že užívateľ môže inhalovať cez koncovú sekciu, aby inhaloval na aerosol prevoditeľnú fannaceutickú formuláciu, ktorá vystúpila zkapsuly cez otvor vytvorenýV inom hľadisku podľa vynálezu aerosolizačné...

Spôsob a zariadenie na usporiadanie komponentov plazmového oblúkového horáka


Číslo patentu: E 8544

Dátum: 09.04.2004

Autori: Brandt Aaron, Currier Brian, Lindsay Jon, Duan Zheng, Shipulski Edward, Anderson Richard, Jones Casey

MPK: H05H 1/34, H05H 1/28

Značky: plazmového, horáka, zariadenie, usporiadanie, komponentov, spôsob, oblúkového


...konca, obklopujúcej vloženú A chladiacu vstupnú rúrku obsahujúcu duté, tenkostenné valcoveteleso vymedzujúce valcový priechod prechádzajúci telesom a jeumiestnené v susedstve duteho vnútorného povrchu tela elektródy. Rúrka vystupuje do vybratia V odstupe, aby poskytla vysokúrýchlosť prúdenia chladiva cez vnútorný povrch elektródy.0007 US 2001/007320 opisuje plazmový oblúkový horák so zlepšeným tesnením spojov medzi tekutinovými...

Motorové vozidlo s kompaktným vyklápacím sedadlom


Číslo patentu: E 1426

Dátum: 09.04.2004

Autor: Marcuzzi Jean-charles

MPK: B60N 2/30

Značky: sedadlom, vozidlo, motorové, vyklápacím, kompaktným


...30.0034 Pri výhodnom spôsobe uskutočnenia vynálezu prebieha os kĺbu 42 sedacej časti naprieč nad priesećnicou zadnej steny 24 a dolnej steny 22 sedacej časti 20.0035 Ovládacím prvkom 41 je doska, ktorá v porovnani s hrúbkou sedacej časti a operadlá je tenká je tuhá a je uložená naprieč. Je buď kovová aleboje zhotovená tvrdého syntetického materiálu.0036 Táto doska 41 má zadnú naprieč prebiehajúcu časť 411 a prednú naprieč prebiehajúcu časť...

Injekčná striekačka bez ihly s optimalizovaným kontajnerom vstrekovača


Číslo patentu: E 1078

Dátum: 09.04.2004

Autori: Baud Georges, Brouquieres Bernard, Alexandre Patrick

MPK: A61M 5/30

Značky: vstrekovača, injekčná, kontajnerom, striekačka, optimalizovaným


...dolný každý diel,ktorý je blízky miestu. vstreku alebo každá časť dielu, ktorá smeruje k miestu vstreku, pričom týmto núestom vstreku je pa cientova pokožka. Naopak adjektívunl horný tu. bude použitý prekaždý diel, ktorý je vzdialený od. miesta vstreku alebo každá časť dielu smerujúca na opačnú stranu, ako je núesto vstreku. Takto vstrekovač zahŕňa dolnú stranu smerujúcu k pokožke pacienta a hornú stranu, ktorá tvorí opačnú stranu...

Benzoxazinyl-amidocyklopentyl-heterocyklické modulátory chemokínových receptorov


Číslo patentu: E 7517

Dátum: 09.04.2004

Autori: Mills Sander, Pasternak Alexander, Yang Lihu, Goble Stephen

MPK: A61K 31/535, A61P 29/00, A61K 31/55...

Značky: benzoxazinyl-amidocyklopentyl-heterocyklické, modulátory, receptorov, chemokínových


...zápalových a imunoregulačných porúch a ochorení vrátane astmy, nádchy a alergických ochorení, ako aj autoimunitných ochorení ako reumatickej artritidy a arteriosklerozy. Ľudia,ktori sú homozygotní s absenciou páru báz 32 génu CCR-5, sú zrejme menej náchylný na reumatickú artritídu (Gomez a kol.,Artritída Rheumatism, 42, 989-992 (1999. Prehľadná publikácia týkajúca sa úlohy eozinofilov pri alergickom zápale je publikácia Kita, H. a kol., J....

Hnacie zariadenie pre pohon prídavných zariadení pre vozidlo


Číslo patentu: E 13768

Dátum: 08.04.2004

Autor: Tarasinski Nicolai

MPK: B60K 6/445, B60K 6/44, B60K 6/365...

Značky: pohon, vozidlo, zariadenie, přídavných, hnacie, zariadení


...hriadeľa a prevodovkou pre vývodový hriadeľ,pričom synchrónne hydraulické ovládanie brzdy a spojky vývodového hriadeľa sa uskutočňuje tak, že brzda sa pri zopnutí spojkyvývodového hriadeľa uvoľní a naopak.Spís EP 1 205 338 A obsahuje hnacie zariadenie podľaÚlohou vynálezu je vytvoriť hnacie zariadenie pre pohon prídavných zariadení pre vozidlo v úvode uvedeného druhu, pomocou ktorého môže byť vyrábaný elektrický prúd, ktorý môže byťTáto...

Farmaceutické prípravky obsahujúce metylnaltrexón


Číslo patentu: E 18105

Dátum: 08.04.2004

Autori: Boyd Thomas, Sanghvi Suketu

MPK: A61K 31/047, A61K 31/195, A61K 31/485...

Značky: farmaceutické, obsahujúce, přípravky, metylnaltrexón


...nepresahuje 1,5 , 1,0 , 0,5 , 0,25 adokonca 0,125 metylnaltrexónu vprípravku. Kompozícia alebo prípravok môže obsahovať jednu znasledujúcich látok, akúkoľvek ich kombináciu alebo všetky nasledujúce látky chelátor, pufrovacie činidlo, antioxidant, kryoprotekčné činidlo, izotonické činidlo aópioid. Výhodný chelátor ajeho koncentrácie sú opísané vyššie. Výhodné pufrovacie činidlo ajeho koncentrácie sú opísané vyššie. Kompozícia alebo...

Farmaceutické prípravky obsahujúce metylnaltrexón


Číslo patentu: E 18083

Dátum: 08.04.2004

Autori: Sanghvi Suketu, Boyd Thomas

MPK: A61K 31/195, A61K 31/047, A61K 31/485...

Značky: přípravky, farmaceutické, obsahujúce, metylnaltrexón


...látok, akúkoľvek ich kombináciu alebo všetky nasledujúce látky chelátor, pufrovacie činidlo, antioxidant, kryoprotekčné činidlo, izotonické činidlo aópioid. Výhodný chelátor ajeho koncentrácie sú opísané vyššie. Výhodné pufrovacie činidlo a jeho koncentrácie sú opísané vyššie. Kompozícia alebo prípravok má pH, ktorénepresahuje 4,25. Výhodné pH a rozmedzia sú opísané vyššie.Podľa ďalšieho aspektu vynálezu sa poskytuje stabilná kompozícia...

Farmaceutické prípravky obsahujúce metylnaltrexón


Číslo patentu: E 18082

Dátum: 08.04.2004

Autori: Boyd Thomas, Sanghvi Suketu

MPK: A61K 31/047, A61K 31/485, A61K 31/195...

Značky: přípravky, farmaceutické, obsahujúce, metylnaltrexón


...činidlo a ópioid. Výhodný chelátor a jeho koncentrácie sú opísané vyššie. Výhodné pufrovacie činidlo a jeho koncentrácie sú opísané vyššie. Kompozícia alebo prípravok má s výhodou pH, ktoré nepresahuje 4,25. Výhodné pH a rozmedzia sú opísané vyššie.Podľa ďalšieho aspektu vynálezu sa poskytuje stabilná kompozícia alebo prípravok podľa nároku 1. Kompozíciou alebo prípravkom je roztok metylnaltrexónu alebo jeho soli, pričom pH je pod...

Spôsob liečenia Parkinsonovej choroby


Číslo patentu: E 6102

Dátum: 08.04.2004

Autori: Benatti Luca, Ruggero Fariello, Salvati Patricia, Cattaneo Carlo

MPK: A61K 31/16, A61P 25/00

Značky: choroby, liečenia, parkinsonovej, spôsob


...terapia obsahuje sañnamid, amantidin, jedno alebo viac liečiv z levodopa/Půls, ako sú levodopa plus karbidopa (SlNEMET®), levodopa plus karbidopa sriadeným uvoľňovaním (SINEMET-CR®), levodopa plus benzerazid (MADOPAR®), a levodopa plus benzerazid s riadeným uvoľňovaním (MADOPAR-HBS), jeden alebo viac zo skupiny entakapon a tolkapón, ajeden alebo viac zo skupiny bromokriptín, kabergolin, lizurid, pergolid, ropinirol, apomorñn,...

Rastlinné spojivo na prípravu materiálov určených pre stavebníctvo a/alebo verejné práce


Číslo patentu: E 16795

Dátum: 08.04.2004

Autori: Poirier Jean-eric, Ballie Michel, Delcroix Thierry

MPK: C04B 26/00, C04B 111/00, C04B 26/22...

Značky: stavebníctvo, přípravu, určených, verejné, práce, materiálov, rastlinné, spojivo


...uvedených cieľov je možné dosiahnuť spojivom rastlinnej povahy na zhotovovanie stavebných materiálov a /alebo verejných prác podľa vynálezu, ktoré je opísané v súbore patentových nárokov a ktoré vo vzťahu k celkovej hmotnosti spojíva obsahuje(a) najmenej jednu prírodnú živicu alebo prírodnú modiñkovanú živicu rastlinného pôvodu s bodom mäknutia meraným podľa normy ISO 4625 o teplote od 100-200 °C, ešte lepšie od 120 do 180 °C(b) 20...

Reverzibilné pegylované lieky


Číslo patentu: E 17396

Dátum: 08.04.2004

Autori: Tsubery Haim, Shechter Yoram, Fridkin Matityahu

MPK: A61K 38/00, A61K 47/48, A61K 38/43...

Značky: pegylované, reverzibilné, lieky


...prehlásenie o obsahu alebo dátume dokumentu je založené na informáciách dostupných pre žiadateľa v čase plnenia a nepredstavuje schválenie správnosti takéhoto prehlásenia.0012 Teraz sa zistilo, vsúlade stýmto vynálezom, že kombináciou technológie pegylácie proteínov stechnológiou derivácie s Fmoc alebo FMS alebo podobnými polovicami, ktoré sa dajú odstrániť za mierne zásaditých podmienok, je možné vyriešiť hlavné deticiencie technológie...

Medicínska náplasť s účinnou látkou opticky menej viditeľná na koži


Číslo patentu: E 5174

Dátum: 08.04.2004

Autor: Bracht Stefan

MPK: A61K 9/70

Značky: medicínska, menej, opticky, látkou, náplast, účinnou, viditeľná, koží


...kdispozícii náplasti s účinnou látkou,ktoré navzdory existujúcemu alebo vpriebehu času sa vyskytujúcemu sfarbeniu poskytujúopticky nenápadný vzhľad náplasti, hlavne keď sa náplasť nachádza na mieste aplikácie. Pritommá byt vynájdené čo najjednotnejšíe riešenie, ktoré je vhodné pre najrôznejšie farebne odtiene kože svetovej populácie. Ďalej bolo úlohou vynálezu vynájsť spôsob, akým je možné získavať také náplasti s účinnou0011 Tieto úlohy sú...

Spôsob liečby Parkinsonovej choroby


Číslo patentu: E 15918

Dátum: 08.04.2004

Autori: Benatti Luca, Ruggero Fariello, Cattaneo Carlo, Salvati Patricia

MPK: A61K 31/16, A61P 25/16

Značky: spôsob, choroby, parkinsonovej, liečby


...každé terapeutické činidlo je podávané v odlišnom čase, ako aj podávanie týchto terapeutických činidiel alebo najmenej dvoch z týchto terapeutických činidieí v podstate súbežným spôsobom. V podstate súbežne podávanie sa môže uskutočniť napríklad podávaním subjektu jednej kapsuly obsahujúcej všetky terapeutické činidlá vo ñxnom pomere alebo podávaním viacerých samostatných tabliet každého terapeutickeho činidla. Postupne alebo v podstate...

Palivová zmes


Číslo patentu: E 15648

Dátum: 08.04.2004

Autori: Posselt Dietmar, Fehr Erich, Schwahn Harald

MPK: C10L 10/00, C10L 1/14

Značky: palivová


...reakciou zo substituovaných fenolov s aldehydmi a mono- alebo polyamínmi.Obsah alkanolov je výhodný. vztiahnuté na celkový objem palivovej zmesi od 10Obsah ďalších alkoholov a éterov v motorovom benzíne je zvyčajne relatívne nízky. Typické maximálne obsahy sú pre terc-butanol 7 obj., pre izobutanol 10 obj. a pre éter s 5 alebo viacerými atómami uhlíka v molekule 15 obj.Obsah aromátov motorového benzínu je výhodnejšie maximálne 40 obj.,...

Substituované benzopyrány ako selektívne agonisty estrogénneho receptora beta


Číslo patentu: E 4278

Dátum: 08.04.2004

Autori: Durst Gregory Lee, Norman Bryan Hurst, Pfeifer Lance Allen, Richardson Timothy Ivo

MPK: A61P 35/00, C07D 311/00, A61K 31/352...

Značky: selektivně, receptora, benzopyrány, substituované, estrogénneho, agonisty


...k nedávnemu objavu ERbeta a vzhľadom k poznaniu, že ER-alfa a ER-beta majú odlišné biologické úlohy, veľké klinické uplatnenie. Pretože ER-beta je silno exprimovaný v mnohých tkanivách, medzi ktoré patri prostata, močový mechúr. vaječník,semenník, pľúca, tenké črevo, cievne endotélium, a rôzne časti mozgu, boli by zlúčeniny, ktoré selektívne modulujú ER-beta klinicky významné v terapii mnohých chorobnýchstavov, ako je rakovina...