Zverejnene patenty 13.04.2004

Balenie s posúvnym viečkom


Číslo patentu: E 7208

Dátum: 13.04.2004

Autori: Pena Javier, Velloni Alessandro, Grandjean Jean-pierre René

MPK: B65D 5/00, B65D 85/08, B65D 5/64...

Značky: posuvným, viečkom, balenie


...stena dna v podstate obdĺžniková (alebo štvorcová) - na pripojenie takýchto stien dna s jednou, dvoma, tromi alebo štyrmi zaoblenými rohmi sú potrebné maximálne štyri stien kontajnera, menovite čelná stena, zadná stena a dve bočné steny. Hrany medzi týmito stenami môžu byť prípadne zaoblené alebo skosené. Avšak jedna alebo viac stien môže chýbať a/alebo môžu byť zmenšené. Napriklad čelná stena môže chýbať alebo môže byť zmenšená a/alebo...

Bezkontaktný nosič dát


Číslo patentu: E 5992

Dátum: 13.04.2004

Autori: Graf Hans, Finkenzeller Klaus, Rossmadl Alfred

MPK: G06K 7/00, G06K 19/14, G06K 19/077...

Značky: nosič, bezkontaktný


...sa číta opticky čitateľný prvý identifikačný prvok a bezkontaktne čitateľný druhý identifikačný prvok a ich identifikačné informácie sa kontrolujú na zhodu (pozripredvýznakové časti nezávislých nárokov). Ako náhle dôjde kzhode, je predmet, označený identifikačnými prvkami, identifikovaný ako správny a uznaný za autentický. Pritom jedruhý identifikačný prvok vytvorený ako elektronicky čitateľnýidentifikačný prvok a umiestnený na...

Spôsob prípravy dialkyl-3-oxoglutarátov


Číslo patentu: E 5230

Dátum: 13.04.2004

Autori: Gregorné Boros Livia, Morasz Tamás, Olah Sándor, Töreki József, Szabo Attila, Jákfalvi Elemér, Tóth Gábor

MPK: C07C 69/00, C07C 67/00

Značky: dialkyl-3-oxoglutarátov, přípravy, spôsob


...ktorá sa uskutoční s použitím zriedenej kyseliny chlorovodíkovej.0010 Nevýhoda vyššie uvedených dvoch metód spočíva v tom, že sa pri nich používajúureakčné činidlá a sú vyžadované reakčné teploty (reakcia s lítiumdiizoipropylamidom sa uskutočňuje pri teplote -45 °C, a na druhej strane použitie amidu sodného a kvapalného amoniaku), ktoré vyžadujú zvláštne zaobchádzanie nevhodné pre výrobu v priemyselnom meradle (ako je napríklad dokonalá...

Výpustný uzáver


Číslo patentu: E 4348

Dátum: 13.04.2004

Autor: Lindmayer István

MPK: B65D 47/04

Značky: výpustný, uzáver


...časť poskytuje dovnútra twrientovantr obrubu elastický trloženťr z onkajsej strany na hrdlelTaše a tcsniaci výčneltrlç otvziurjťrci ústie lľase a elastický Lrloženy x. vnútra k nemu.Výpustný uzáver napísaný v prihláške má výhodne charakteristické znaky.montážna čast poskytuje stúpajúci orientovaný kŕčok na jeho okraji sedia v drážke tvorenej stenou viečka a paralelne zostupne ttsmerneny vnútornou stenou.Výpustný uzáver opísaný v prihláške...

Spôsob prípravy N-terminálom modifikovaných chemotaktických faktorov


Číslo patentu: E 3895

Dátum: 13.04.2004

Autori: Lenter Martin, Seidler Randolph, Doods Henri, Wandl Robert, Necina Roman

MPK: A61K 38/19, A61P 9/00, C07K 14/435...

Značky: n-terminálom, chemotaktických, spôsob, modifikovaných, faktorov, přípravy


...MCP-l proteínu izolovaného zprírodného zdroja je N-koniec blokovaný. Ako sa zístilo neskôr, toto naznačuje na posttranslačnú modiñkáciu, pri ktorej sa glutmnín, uvoľnený po odštiepenícagttcaatg atttgaatga cttcctggct atgctttcatccccatcctc tcacccccct cagatttaac ctćtccccct gagaccaacc aaagtctctg Ctcgctcagc gttatcatgg caagataagg gcagagcctg atccagctct gatcagggta cagaatctgg tgagtatcag gtggggctcc gacacttgta ttatataccc ctctgaggta ttttgttttt...

N-[(piperazinyl)hetaryl]arylsulfónamidové zlúčeniny s afinitou k dopamínovému D3 receptoru


Číslo patentu: E 3633

Dátum: 13.04.2004

Autori: Unger Liliane, Geneste Hervé, Grandel Roland, Haupt Andreas, Braje Wilfried, Lubisch Wilfried, Drescher Karla, Turner Sean, Sauer Daryl

MPK: A61K 31/505, A61K 31/44, A61P 13/00...

Značky: n-[(piperazinyl)hetaryl]arylsulfónamidové, dopamínovému, receptoru, zlúčeniny, afinitou


...fenyl alebo benzyl aR 6, R 7 sú každý nezávisle vybraný z Cl-C 4-alkylu, Cg-Cphalogénalkylu alebo spoločne s dusíkom, ku ktorému sú viazané, vytvárajú nasýtený 3-, 4-, 5- alebo 6-členný heterocyklus,ktorý navyše môže zahŕňať atóm kyslíka alebo ďalší atóm dusíka v kruhu, a ktorý môže niesť l,2, 3 alebo 4 Cl-Cą alkylové skupinyich N-oxidy a fyziologicky prijateľné adičné soli týchto zlúčenín s kyselinou.0009 Tieto zlúčeniny...

Spôsob prípravy 4,10beta-diacetoxy-2alfa-benzoyloxy-5beta,20-epoxy-1,13alfa-dihydroxy- 9-oxo-19-norcyklopropa[g]tax-11-enu


Číslo patentu: E 3454

Dátum: 13.04.2004

Autori: Amouret Guy, Didier Eric

MPK: C07D 305/00

Značky: spôsob, přípravy, 9-oxo-19-norcyklopropa[g]tax-11-enu, 4,10beta-diacetoxy-2alfa-benzoyloxy-5beta,20-epoxy-1,13alfa-dihydroxy


...vyššie uvedených troch patentoch je zlepšený použitím sulfolánu.0011 Zlúčenina nasledujúceho vzorca (I)Ar znamená radikál aryl, R znamená atóm vodíka alebo acetylový, alkoxyacetylový alebo alkylový radikál, R 1 znamená benzoylový radikál alebo radikál R 2-O-CO-, v ktorom R 2 znamená priamyalebo rozvetvený alkylový radikál obsahujúci 1 až 8 atómov uhlíka, sa pripraví spôsobomspočívajúcom v uvedení zlúčeniny vzorca (II)V ktorom R znamená...

Spôsob zhodnotenia ťažkých surovín odasfaltovaním a hydrokrakovaním na ebulovanom lôžku


Číslo patentu: E 3266

Dátum: 13.04.2004

Autori: Gueret Christophe, Kressmann Stéphane, Verstraete Jan

MPK: C10G 69/00

Značky: spôsob, surovin, odasfaltovaním, zhodnotenia, ťažkých, ebulovanom, lôžku, hydrokrakováním


...spracovanie alebo vyžadujúce iba mierne dodatočné spracovanie.0010 Tento vynález sa teda zameriava na spôsob spracovania suroviny uhľovodíkov, z ktorých minimálne 95 hmotn. sú tvorené zlúčeninami, ktoré majú teplotu varu aspoň 340 C, ktorý je charakteristický tým, že obsahujea) sa spája surovina srozpúšťadlom tak, aby sa získal odasfaltovaný nástrek, ktorý má obsah asfalténov (nerozpustných v n-heptáne podla normy NF-T-60-115) nižší ako...

Spôsob a forma na výrobu ozubených remeňov na prenos sily


Číslo patentu: E 2733

Dátum: 13.04.2004

Autori: Song Tao, Lederer Steven Andrew, Wegele Brian Dean

MPK: B29D 29/00, F16G 5/00

Značky: remeňov, ozubených, spôsob, prenos, výrobu, forma


...meniť na základe obvodovej dĺžky remeňa Až doposiaľ bola na výrobu remeňa danej obvodovej dĺžky požadovaná špecifická, jednoúčelová fonna, umožňujúca potrebný optimalizovaný sled rozstupov. Pretože vytvorenie špecifickej formy prekaždú dĺžku remeňa je cenovo nedostupné, bola priemyselná prax pomalé pri prijímaní techník na znižovanie hluku vdezéne a sledu zubov vremeňoch rôznych dĺžok. Kým sa táto prax nevyvaruje nákladného rozširovania...

Otočné alebo natáčacie zariadenie a pripojovací modul na otočné alebo natáčacie zariadenie


Číslo patentu: E 1602

Dátum: 13.04.2004

Autor: Hoch Andreas

MPK: F15B 15/00

Značky: modul, připojovací, zariadenie, natáčacie, otočné


...puzdra umiestnených blokovacích uložení, a tým nepriamo alebo bezprostredne do puzdra. Následne sa zaistíPodľa vynálezu môže byť ďalej také usporiadanie, že blokovací piest má uloženie pre blokovacie prostriedky a na uloženie sa napájajúce vodiace skosenie na nútené vedenie blokovacích prostriedkov pri dosiahnutí blokovacej polohy. Cez definované vodiace skosenie sa blokovacie prostriedky nútene vedú radiálne smerom von do zo strany puzdra...

Povlak na báze vody s vysokou odolnosťou proti abrázii


Číslo patentu: E 1105

Dátum: 13.04.2004

Autori: Rahim Marufur, Pinter Michael

MPK: C04B 35/63, C09D 5/02, C09D 183/04...

Značky: proti, vysokou, odolnosťou, abrázii, povlak, báze


...prípadne pridanými zložkami.Povlak ktorý má vysokú odolnost proti abrázii sa získa kom bináciou nitridu bóru a silikónovej živice. Nitrid bóru je vo forme bieleho prášku ktorý má špecifickú hmotnost v rozsahu 1,5 a 2,5 a teplotu topenia asi 3500 F. Nitrid bóru je výhodne vo forme kockovej alebo hexagonálnej kryštalickej štruktúry. Najvýhodnejšie je nitrid bóru vo forme hexagonálnej kryštalickej štruktúry. Veľkost častíc nitridu bóru je...

Kompozícia vodného tekutého koncentrátu pendimetalínu


Číslo patentu: E 7974

Dátum: 13.04.2004

Autor: Goldsmith Andrew

MPK: A01N 25/30, A01N 25/28, A01N 33/18...

Značky: kompozícia, tekutého, koncentrátů, vodného, pendimetalínu


...sú voľne tečúce kompozície, kde sú mikroenkapsulované častice pendimetalínu a nezapuzdrené častice pendimetalínu voľne dispergované vo vodnom suspenznom prostredí. Tieto kompozície ostávajú stabilné celé mesiace pri teplotách presahujúcích 35 C a dokonca aj pri teplotách presahujúcích 45 °C. Navyše tieto kompozície nevykazujú spomalené uvoľňovanieKompozície podľa vynálezu obyčajne obsahujú pendimetalín v celkovej koncentrácii 200 až 600...