Spôsob detekcie a kvantifikácie Mycobacterium avium subspecies paratuberculosis polymerázovou reťazovou reakciou v reálnom čase

Číslo patentu: E 12869

Dátum: 11.04.2008

Autori: Králík Petr, Slana Iva, Pavlík Ivo

Je ešte 8 strán.

Pozerať všetko strany alebo stiahnuť PDF súbor.

Text

Pozerať všetko

0001 Vynález sa týka spôsobu detekcie a kvantifikácíe Mycobacterium avium subspecies paratubercu/osis (MAP) polymerázovou reťazovou reakciou v reálnom čase (real time PCR). Konkrétne sa jedná o dva nezávislé real time PCR systémy, ktoré detekujú dva Iokusy IS 900 a F 57,špecifické pre MAP.0002 MAP je intracelulárne parazitujúca baktéria, ktorá je pôvodcom chronického zápalového ochorenia čriev prežúvavcov, nazývaného paratuberkulóza alebo tiež Johneho choroba. Nakazené zvieratá trpia chronickou hnačkou a postupným chudnutím. Charakteristickým prejavom paratuberkulózy prežúvavcov je dlhá inkubačná doba a široká individuálna variabilita v predklinickej a klinickej fáze rozvoja ochorenia (Ayele et al., 2001).0003 MAP je u prežúvavcov vylučovaná predovšetkým v truse, v spermiách a v mlieku. A práve prítomnosť MAP v mlieku a v mliečnych výrobkoch, ktoré môžu byť možným mediátorom prenosu MAP na človeka, je významná z hladiska bezpečnosti potravín (Grant, 2006). Mykobaktérie sú relatívne odolné voči rôznym teplotám a boli kultivačne preukázané v mlieku pasterizovanom pri 71 a 72 °C (Ayele et al., 2005).0004 MAPje považovaná za jedného z možných pôvodcov Crohnovej choroby u ľudí, ktorá sa tiež prejavuje zápalovým ochorením črevného traktu (Chamberlin et al., 2001 Bull et al., 2003). Presná etiológia tohto ochorenia nie je známa, ale v súčasnej dobe je akceptovaný model autoimunitného ochorenia. Tento model nepredpokladá prítomnosť živých MAP v tele pacienta. Toto je možný dôvod, prečo u mnohých pacientov s Crohnovou chorobou nebolo kultivačne MAP zachytené, ale boli preukázané len nižšie uvedené špecifické Iokusy (Baksh et al., 2004). Najviac rizikovou skupinou sú v tomto ohľade deti ajedinci s oslabeným imunitným systémom (Chamberlin el al.,2001 Hruska et al., 2005).0005 Diagnostika MAP infekcií sa v dnešnej dobe vykonáva množstvom mikrobiologických,imunologických aj molekulámych biologických metód. Za zlatý štandard priameho preukazu pôvodcu paratuberkulózy je v súčasnej dobe považované kultivačné vyšetrenie. Nevýhodou tejto relatívne spolahlivej metódy je dlhá doba rastu MAP in vitro (minimálne 2 až 3 mesiace). Nepriame sérologické metódy, ktoré sú založené na preukázaní protilátok proti pôvodcovi paratuberkulózy predovšetkým v krvi, sú špecifické a málo citlivé (Lombard et al., 2006). Často sa získajú bud falošne negatívne výsledky alebo krížovo reagujú s protilátkami geneticky príbuzných mykobaktérií z prostredia. Tieto výsledky vyžadujú overenie priamym detekciou MAP.0006 Z molekulárne biologických metód sa v dnešnej dobe na priamu detekciu pôvodcu paratuberkulózy používa rad systémov založených na konvenčnej alebo nested PCR. Najčastejšie sa na detekciu používajú dva Iokusy špecifické pre MAP. Inzerčná sekvencia IS 900 (X 16293 Green et al., 1989) sa v genóme MAP vyskytuje v 12 až 18 kópiàch (Bull et al., 2000) a je považovaná za zlatý štandard v detekcii MAP pomocou PCR. Genetický element F 57 (X 70277) je v genóme MAP prítomný iba v jednej kópií (Poupart et al., 1993). Je potrebné však potvrdenie výsledkov dosiahnutých PCR, najmä ak sú využívané v rutinnej diagnostike. Toto väčšinou predstavuje použitie hybridizácie nukleových kyselín so špecifickou sondou, čo však robí celý proces náročnejšim a použitelným len pre výskumnú činnosť.0007 Existuje niekolko publikovaných metód na detekciu MAP v rôznych dostupných materiáloch(McKenna et al., 2004. Vasnick et al, 2004. Tasara et al, 2005), ktoré používajú IS 900 a F 57sekvencie ako ciele pre detekcíu MAP. Tieto systémy sú založené na konvenčnej alebo nested PCR a takéto prístupy sú povinné mat určitý druh vonkajšej kontroly špecifickosti PCR produktov. To môže byť vykonané napríklad hybridizáciou s konkrétnou sondou alebo sekvenovaním a/alebo PCR-RFLP analýzy, ktorá je časovo náročná a vyžaduje dalšie výdavky (Rodriguez Lazaro et al.,2005).0008 V poslednej dobe sa používa na detekcíu a prípadnú kvantifikáciu MAP v biologickom materiáli metóda real time PCR (Kim et al., 2002 OMahony and Hill, 2002 Herthnek and Bolske,2006). Je založená na vizualizácii vznikajúcich PCR produktov pomocou fluorescenčných farbív. Jej výhodou je vysoká špecifickosť a citlivosť. V doteraz nami známej publikovanej literatúre sa používajú dve stratégie fluorescenčného značenia (1) inkorporácia dsDNA špecifického fluorescenčného farbiva SYBR Green do novo vznikajúcich PCR produktov alebo (2) využitie krátkych oligonukleotídov (hybridizačných sond), ktoré sú značené fluorescenčnými farbivami a ležia v oblasti amplíñkovanej primérmi. Tým zabezpečujú v real time PCR, okrem primérov, tzv druhú špecifitu.0009 Prvý prístup umožňuje preukázanie prítomnosti MAP v analyzovanom materiáli a určenie špecifíckosti PCR produktu iba podľa dĺžky PCR produktu na základe denaturačnej krivky. Samozrejme, toto určenie špeciíickosti nie je sekvenčne špecifické a závisí predovšetkým od percentuálneho zastúpenia jednotlivých nukleotidov vo výslednom PCR produkte (OMahony a Hill,2002 Rawa and Stanker, 2005). Na overenie sekvenčnej špecifickosti je teda nutné použit dodatočnú hybridizácii, ked nie je možné aplikovať internú ampliñkačnú kontrolu (IAC). Použitie lAC je dnes nutné predovšetkým pre diagnostické účely, pretože predstavuje jediný nástroj, ako odlíšiť falošné negatívne vzorky od skutočne negatívnych. Druhý prístup, za predpokladu, že sekvencia amplifikovaného úseku je jedinečná pre MAP, umožňuje vykonávať kvalitatívne aj kvantitatívne analýzy bez nutnosti ďalšieho overovania špeciñckosti.0010 Najčastejšie používanými typmi sond na detekcíu MAP sú (1) hydrolyzačné sondy alebo (2) FRET (Fluorescencía resonance energy transfer) sondy.0011 Pri použití hydrolyzačných sond dochádza pri ampliñkácii k rozštiepeniu sondy exonukleázovou aktivitou DNA polymerázy, čím je uvoľnený fluórofor. lch výhodou je, že sú použiteľné na akomkoľvek z dostupných real time PCR prístrojov. Naproti tomu FRET sondy sú založené na súčasnej hybridizácii dvoch sond, z ktorých jedna nesie fluórofor na svojom 3 konci(donor) a druhá je značená na 5 konci iným fluóroforom (akceptor). Emisia enerie donora je zachytená akceptorom, ktorého vlnová dĺžka je meraná. Použitie FRET sond je obmedzené iba na prístroje od ñrmy Roche (OMahony a Hill, 2004 Tasara a Stephan, 2005). Využitie akýchkoľvek sond tiež umožňuje v jednej real time PCR reakcii koampliñkáciu lAC, ktorá je značená iným fluóroforom ako sonda pre cieľovú sekvenciu (Rodriguez-Lazaro et al., 2005 Brey et al., 2006).0012 Uvedené nevýhody sú eliminované spôsobom detekcie a kvantifikácie Mycobacterium avíum subspecies paratuberculosis (MAP) dvoma konkurenčnými polymerázovými retazovými reakciami(PCR) v reálnom čase, každá s jeho vlastnou internou ampliñkačnou kontrolou, ktorá sa vyznačuje tým, že detekcia a kvantifikácia MAP sa vykonáva dvoma nezávislými real time PCR systémami,ktoré detekujú dva lokusy špecifické pre MAP IS 900 a F 57, s využitím primérov a hydrolyzačných sond s nasledujúcimi sekvenciamiIS 900 qPCRF GATGGCCGAAGGAGATTG lS 900 qPCRR CACAACCACCTCCGTAACC, sonda pre IS 900IS 900 qPCRTM FAM - ATTGGATCGCTGTGTAAGGACACGT - BHQ,pričom sonda pre internú amplifikačnú kontrolu má nasledujúcu sekvenciu0013 Spôsob podľa vynálezu je dalej charakterizovaný tým. že stanovenie MAP sa vykonáva vo vzorkách akéhokoľvek živočíšneho pôvodu, najmä pochádzajúcich z hospodárskych zvierat a v klinických vzorkách pochádzajúcich z humánnych pacientov, vo vzorkách rastlinného pôvodu, vo vzorkách prostredia, najmä z hnojív, prachu, sena, vo vzorkách pochádzajúcich z archeologických nálezov a vo vzorkách potravín a krmív.0014 Detekčné súpravy na detekciu a diagnostiku MAP spôsobom podľa vynálezu sú tiež súčasťou podstaty vynálezu a sú charakterizované tým, že obsahujú všetky oligonukleotidové priméry a sondy, ktoré sa používajú na uskutočnenie spôsobu podľa vynálezu.0015 Spôsob podľa vynálezu sa týka dvoch nezávislých real time PCR systémov na detekciu a kvantifikáciu MAP v biologickom materiáli. Ich podstata spočíva v amplifikácii Iokusov špecifických pre MAP. Prvý je založený na amplifikácii inzerčnej sekvencie IS 900 a druhý na amplifikácii genetického elementu F 57. Každá vzorka je analyzovaná obidvomi systémami. Výhodou je, že pozitivita každej vzorky je overená dvomi nezávislými reakciami, čím sa vylučuje riziko pripadnej falošnej pozitivity. IS 900 real time PCR je cltlivejšia, avšak nedovoľuje presné stanovenie množstva MAP v analyzovanej vzorke. Naproti tomu, genetioký element F 57 je v genóme MAP prítomný iba v jednej kópií a je preto vhodný na presnú kvantitikáciu MAP buniek vo vzorke.0016 Obidva real time PCR systémy sú založené na použití hydrolyzačných sond označených FAM (ô-karboxyfluoresceín) a je teda možné ich použiť na všetkých dostupných real time PCR prístrojoch bez nutnosti ďalšieho overovania špecifickosti.0017 Obidva systémy obsahujú vlastnú plazmidovú IAC, ktorá je založená na kompetitívnej PCR(sekvencia primérov pre cieľovú sekvenciu IS 900 alebo F 57 sú identické s príslušnou lAC). Použitie iba jednej súpravy primérov na ampliñkáciu dvoch PCR produktov v jednej real time PCR reakcii znižuje riziko vzniku nešpeciñckých PCR produktov a tým aj zníženie efektivity PCR v analyzovaných reálnych vzorkách. Vnútorné sekvencie oboch IAC sú identická, čo umožňuje používat v oboch PCR systémoch iba jednu sondu pre IAC značenú Cy 5. Použitie iba jednej súpravy primérov pre každú real time PCR reakciu a jednej sondy pre IAC znižuje celkové finančné náklady na chemikálie potrebné na analýzu.0018 Protokol pre analýzu je v oboch real time PCR systémoch zhodný. To je výhodné pri spracovaní menšieho množstva vzoriek. V jednom ,experimente môžu byť totiž súbežneanalyzované tie isté vzorky obidvomi real time PCR systémami, čím dochádza k významnej úspore finančných nákladov a času potrebného na jednu analýzu, 0019 Štandardy pre obidva real time PCR systémy boli pripravené naklonovaním PCR produktov pre IS 900 a F 57 do plazmidového vektora. lzolovaná plazmidová DNA bola zriedená v rozsahu od 1 x 105 do 1 × 10 ° kópií plazmidu na JI na reakciu. Flslušná r iediaca séria bola amplifikovaná v každom experimente. Slúžila jednak ako pozitívna kontrola ampliñkàcie a jednak ako zdroj dát pre konštrukciu kalibračnej krivky a tým aj na stanovenie efektivity PCR plazmidového gradientu vypočítanej podľa regresnej rovnice krivky. Kalibračná krivka slúžila na presnú kvantiñkáciu MAP v neznámych vzorkách.0020 Spôsob podla vynálezu, založený na ampiifikácii dvoch iokusov špecifických pre MAP pomocou real time PCR, je optimalizovaný pre rutinnú diagnostiku MAP z rôznych typov biologického materiálu. Hlavnou výhodou je univerzálnost (možnosť aplikácie v rôznych Iaboratóriách a na rôznych prístrojoch bez nutnosti ďalšej optimalizácie), časová nenáročnosl a nízke náklady kombinované s vysokou špecifickosťou. citlivosťou a reprodukovatelnosť.0021 Nasledujúce príklady uskutočnenia spôsobu podla vynálezu iba dokumentujú spôsob.Príklad 1 0022 Spôsob podla vynálezu spočíva z niekoľkých krokovDNA materiál. Na overenie špecifickosti vyvinutých real time PCR systémov boli použité DNA templáty zo 17 bakteriálnych a 4 cicavčlch druhov (Tabulka 1).0023 Na overenie izolácie DNA a vyvinutých real time PCR systémov boli použité vzorky mlieka od 71 kráv zo stáda inñkovaného paratuberkulózou. Pôdoj od každej kravy (prvé 3 až 4 odstreky z každého zo štyroch strukov, ktoré sa vylievajú) bolí odobraté do jedného 200 ml jednorázového sterilného plastového kontajnera. V chladiacom boxe boli pôdoje transportované do laboratória, kde boli uchované pri teplote 4 C a do 3 dní spracované. Z každého odberu boli spracované 2 na sebe nezávislé vzorky jedna bola použitá na izoláciu DNA a druhá slúžila ako záloha pre prípad zlyhania izolácie DNA alebo real time PCR.0024 Návrh primérov a sond. Priméry a sondy pre inzerčnú sekvenciu IS 900 (X 16293) a fragment F 57 (X 70277) boli navrhnuté programom Primér 3 httpIlfrodo.wi.mit.edu/cgibin/primer 3/primer 3 www.cgi, (Tabuľka 2).0025 Príprava plazmidových štandardov. Na prípravu plazmidových štandardov pre IS 900 a F 57 real time PCR, boli PCR produkty IS 900 a F 57 amplifikované konvenčnou PCR za použitia HotStar PCR Master Mix Kit (Qiagen, Hilden, Nemecko), 10 pmol primérov lS 900 qPCRF a ISQOOqPCRR alebo F 57 qPCRF a F 57 qPCRR a 2 l lyzovanej MAP suspenzie (zbierkový kmeň CAPM 6381 Zbierka zvieracích patogénnych mikroorganizmov - Collection of Animal Pathogenic Microorganisms, Brno httpl/www.vri.czllabslpatogen/default.htm) v celkovom objeme 20 l. PCR amplifikácia prebiehala za nasledujúcich podmienok úvodná denaturácia 95 °C po dobu 15 min,nasledovaná 30 cyklami denaturàcie pri 95 °C po dobu 20 s, zosilnenie pri 60 °C počas 30 s,extenzia pri 72 C po dobu 1 min a záverečná extenzia pri 72 °C po dobu 5 min. Bez ďalšej purifikácie boli získané PCR produkty naklonované do vektora PCR 2.1 (lnvitrogen, Carlsbad, USA) podľa návodu výrobcu.0026 Plazmidy obsahujúce inzerty IS 900 (Tuoro) a F 57 (Beren) boli purifikované kitom QIAprep

MPK / Značky

MPK: C12Q 1/68

Značky: reálnom, reakciou, avium, reťazovou, spôsob, čase, polymerázovou, kvantifikácie, subspecies, mycobacterium, detekcie, paratuberculosis

Odkaz

<a href="http://skpatents.com/16-e12869-sposob-detekcie-a-kvantifikacie-mycobacterium-avium-subspecies-paratuberculosis-polymerazovou-retazovou-reakciou-v-realnom-case.html" rel="bookmark" title="Databáza patentov Slovenska">Spôsob detekcie a kvantifikácie Mycobacterium avium subspecies paratuberculosis polymerázovou reťazovou reakciou v reálnom čase</a>

Podobne patenty