Spôsob na identifikáciu kolorektálnych nádorov

Číslo patentu: E 8937

Dátum: 27.02.2004

Autori: Calistri Daniele, Rengucci Claudia

Je ešte 6 strán.

Pozerať všetko strany alebo stiahnuť PDF súbor.

Text

Pozerať všetko

0001 Tento vynález sa vo všeobecnosti týka diagnostiky nádorov u ľudských pacientov a u zvierat. Konkrétne poskytuje spôsob a súpravu na včasnú diagnostiku kolorektálneho karcinómu a určenie predrakovinových Iézil hrubého čreva a konečníka, Spôsob podľa vynálezu je založený na kvantiñkácíi DNA extrahovanej zo stolice a ampliñkovanej PCR technikami.0002 V posledných rokoch sa nahromadilo veľké množstvo informácii o molekulových zmenách, ktoré prebiehajú počas vývoja nádorov, ako sú napríklad genove mutácíe alebo genomické preskupovania,zdôrazňujúc možnost zisťovania nádorových zmien v biologických tekutinách a následne naznačujúc používanie týchto markerov ako funkčný neinvazívny diagnostický prístup.0003 Nádorom, ktorý sa týmto prístupom vo veľkej miere skúmal, je kolorektálny karcinóm, jedna z najbežnejšlch foriem rakoviny na celom svete, pri ktorom sa klinický výsledok značne líši v závislosti od typu lézíe a štádiu ochorenia v časejeho diagnostikovania (1-3). Včasná diagnostika je základnou podmienkou na zníženie chorobností a úmrtnosti, keďže vysoké percento pacientov, ktorí boli diagnostikovaní vo včasnom štádiu ochorenia, zostava dlho nažive (4). Okrem toho skutočnosť. že sa môžu detegovat premalígne lezie, sa tento nádor stáva ideálnym cieľom skriningových programov. Hoci je k dispozicii niekoľko skriningových spôsobov, vysoké percento jedincov sa nezapája do skriningových programov na kolorektárny karcínóm. Existuje mnoho dôvodom tejto nízkej ochoty, napríklad nedostatočne vedomosti o prínose dostupných skriningových spôsobov, najmä kolonoskopíe, ako aj nepríjemne a komplikovaná postupy (5).0004 Opakovane sa skúmali génové mutacíe v stolici, najmä K-ras (6-12) a v menšom rozsahu p 53 (13),APC gén (14,15) a mikrosatelitová nestabilita (16). Výsledky ukázali, že len cast pacientov má v stolici tieto molekulárne zmeny. a to kvôli relatívne nízkej frekvencii zmien jediného markera pri kolorektàlnom karcinóme. Aaceré rozne mutácie sa paralelne analyzovali v tej istej vzorke stolice a tento prístup viedol k zlepšeniu citlivosti testov, aleje nákladný, časovo náročný a nedá sa jednoducho aplikovat v skriningových programoch0005 Nedávno sa zvažoval díagnostický potenciál DNA amplifíkácie odlúpených buniek v stolici. Predbežné dôkazy (19-21) ukazujú, že semikvantitatívne vyhodnotenie DNA amplifikácie (L-DNA) niektorých DNA fragmentov, ktoré sú dlhšie ako 200 bp, deteguje viac ako 50 kolorektálnych karcinomov s veľmi vysokou špecificitou.0006 US prihláška č. 20020004206 opisuje genetický test na identíñkáciu nádoroveho ochorenia zo vzoriek. obsahujúcich odlúpene epiteliálne bunky. Patentová prihláška opisuje test, zahrnujúci krok PCR amplifikácie Kras, APC a p 53 fragmentov, po ktorom nasleduje semíkvantítatlvne stanovenie amplifíkovanej DNA na základe farbenia gélu.0007 US 5723298 opisuje spôsob značenia a sekvenovania nukleokyselinových molekúl, konkrétne DNA molekúl, v ktorých sa interne značený, čiastočne predĺžený primér, predlžuje v cyklickej reakcií predlžovania primára. a súpravu na prípravu vzoriek na analyzovanie nukleokyselinovej sekvencie, ktorý obsahuje neznačený nukleokyselinový prímér, značený dNTP, tri neznačené dNTP, termostabilnú polymerázu a reakčný tlmivý roztok pre termostabilnú polymerázu.0008 W 0 01/42502 opisuje sposob detekcie ochorenia, ktorý zahrnuje, inter alfa, uskutočňovanie PCR amplitikacie DNA purifikovanej zo vzoriek stolice od pacientov, u ktorý sa prejavuje kolorektálny karcínom. Priméry používané pri tomto ampliñkačnom postupe sú určené na ampliñkovanie 5 alebo 7 rôznych Iokusov DNA, umožňujúc amplifikáciu DNA fragmentu s dĺžkou viac ako 200 bp. Množstvo amplikónov sa potom porovnáva s referenčnou hodnotou. Na kvantifikáciu amplífikovanej DNA sa používa farbenie etídium bromidom.0009 W 0 02/092858 opisuje spôsoby na skrining ochorení. Jeden z opisaných spôsobov zahmuje uskutočňovanie diagnostického spôsobu na detekciu prítomnosti druhovo špecifických nukleových kyselín. indikujúcich rakovinu alebo predrakovinový stav v biologickej vzorke. Tento spôsob zahrnuje ampliñkáciu nukleových kyselín v reprezentatívnej vzorke stolice za použitia pre človeka špecifických primérov a detegovanie amplikónov dlhších ako 200 bp prostredníctvom farbenia etídium bromidom, pričom tieto PCR priméry sú zvolené tak. aby konkrétne detegovali gény, o ktorých je známe, že súvisia s koiorektálnym karcinómom, alebo ktoré sú podozrivé z takejto spojitosti. Pri tomto spôsobe je PCR amplifikácia navrhnutá tak, aby sa amplifikovalo 7 rôznych Iokusov s d žkou najmenej 200 bp. Výsledná amplifikácia sa potom porovnáva s referenčnou hodnotou.0010 Rengucci a kol., Clinical Cancer Research, 7 590-593 (2001), opisujú detekciu genetických zmien,konkrétne p 53 a k-ras mutácií a mikrosatelitovej nestabílity, pri skriningu kolorektálnych nádorov.0011 Predložený vynález je založený na novom. presnom a rýchlom spôsobe detekcie rakoviny, ktorýumožňuje lepšie rozlišovanie postihnutých a nepostihnutých jedincov. 0012 Konkrétne je predmetom vynálezu spôsob kvantifikácie DNA zo vzoriek stolice, ktorý je užitočný na vćasnú diagnostiku nádorov a predrakovinových lezii rakoviny hrubého čreva a konečníka, ktorý zahrnujea) extrakciu DNA zo vzoriek stolice b) PCR ampliñkáciu 8 rôznych DNA fragmentov, ktoré prechádzajú rôznymi obIastami p 53 a APC génov za použitia deoxynukleotidtrifosfátov alebo primérov značených fluorescenčnými molekulami, pričom p 53fragmenty zodpovedajúce exonom 5-8 sa amplifikujú použitim nasledovných párov primérova APC tragmenty sa ampliñkujú za použitia nasledovných párov primérovc) kvantilikàciu ampliñkovaných fragmentov (amplikonov)d) výpočet celkového množstva roznych amplikónov e) porovnanie hodnôt získaných v kroku (d) s referenčnou hodnotou, pričom referenčná hodnota sa stanovujena základe prlpadových sérií, zahrnujúcich zdrave subjekty a pacientov postihnutých kolorektálnym nádorom alebo Iéziami.0013 Extrahovanie DNA sa môže uskutočňovať bežnými technikami použitím komerčne dostupných súprav. DNA fragmenty amplifikované v kroku (2) môžu zahrnovat jeden alebo viacero neprekrývajúcich sa oblastí genómu, vrátane génov a nekódujúcich sekvencil s podmienkou, že dlžka fragmentu je väčšia ako 100 bp(bázových párov). výhodne 100 až 1 000 bp, a najvýhodnejšie 100 až 500 bp. Fragmenty sa môžu ampliñkovat oddelene alebo súčasne v pripade, že sa amplifikujú súčasne, mali by sa amplifikačné produkty navzájom odlišovať prostredníctvom.vhodného fluorescenčného značenia. Výhodne primérové oligonukleotidy alebo deoxynukleotidtrífosfáty používané v amplifikačnej reakcii nesú nasledovné fluorescenčné molekuly(fluorochromy) HEX (Applied Biosystems), ô-FAM (Applied Biosystems) a TAMRA (Applied Biosystems). alebo iné molekuly, ako napríklad fluoresceln, rodamín, Cy 3, Cy 5, 5-FAM Ned, Vic a Pet. Tieto markery sú chemicky naviazané na jeden alebo na viaceré nukleotidy vo vnútri alebo na koncoch primérových sekvencií,výhodne na prvý nukleotidový zvyšok. alebo sú spojené s deoxynukleotidtrifosfátmi. nachádzajúcimi sa v PCR reakčnej zmesi.0014 Ampliñkujú sa nasledovné genómové fragmenty exóny 5 až 8 p 53 (Gene Bank č. X 54156, nt. 1304213253, 1330843489, 13986-14124, 1440444603) a genómové oblasti kodujúce aminokyseliny 862-954,1035-1130, 1288-1402 a 1421-1515 APC (exón 15 - Gene Bank AF 127506, M 74088).0015 Vdalšom výhodnejšom uskutočnení sa produkty amplifikácie kvantifikujú prostredníctvom automatizovaných DNA sekvenátorov/analyzátorov, výhodne použitím 3100 Avant Genetic Analyzer® (Applied Biosystems). Ďalšie techniky vhodné na ampliñkáciu fragmentov podľa vynálezu zahrnujú imunoenzymatické techniky, PCR v reálnom čase a chemiluminiscenčné techniky.0016 PCR amplifikácia sa výhodne uskutočňuje v prítomnosti internej kontroly na detekciu Taq inhibítorov. Do PCR reakčnej zmesi sa napriklad može pridat plazmid obsahujúci sekvenciu. ktorá tiež nie je ľudská,amplifikovateľný so sadou primérov, používaných na amplifikáciu cieľovej DNA. Tato interná kontrola umožňuje zabránil falošným negatívnym výsledkom z dôvodu prítomnosti Taq inhibitorov.0017 Na stanovenie množstva každého amplikónu treba pripravil kalibračnu krivku prostredníctvom amplifikácie známych riedenl genomickej DNA alebo plazmidov, obsahujúcich nukleotidové sekvencie cieľových DNA fragmentov použitím rovnakých primérov a rovnakých podmienok ako pre testované vzorky. Keď sa napríklad používa automatický sekvenátor/analyzátor fragmentov, AUC (plocha pod krivkou) hodnoty sa získajú z amplifikácie známych množstiev DNA a vynesú sa do kalibračnej krivky množstvá DNA v testovaných vzorkách sa potom interpolujú na rovnakú krivku.0018 Celkové množstvo ampliñkačných produktov zodpovedajúce roznym fragmentom (tzn. súhrn množstiev jednotlivých amplikonov), vyjadrené v hmotnostných jednotkách, sa potom porovnáva s referenčnou alebo hraničnou (cut-off) hodnotou, ktorá sa vopred stanovila na základe prípadových sérii, zahrnujúcich zdravé subjekty a pacientov, u ktorých sa stanovila prítomnost kolorektálnych nádorov alebo Iézií. Tieto prípady musia zahrnovat dostatočný počet pacientov a kontrol na to, aby poskytli dobrý interval dôveryhodnosti (Cl 95 ). výhodne najmenej 50 pacientov a 50 zdravých dobrovoľníkov.0019 Presnosťou, citlivostou a špeciñckostou tohto spôsobu sa stava mimoriadne užitočným na včasnú diagnostiku kolorektárnych nádorov a vyhodnocovanie rizika alebo pravdepodobnosti vývoja takýchto nádorov u osob s predrakovinovými kolorektálnymi Iéziami. Ďalšími výhodami tohto spôsobu sú jehojednoduchost,rýchlosť a nízke náklady.0020 Ďalší aspekt vynalezu sa týka súpravy, vhodnej na uskutočňovanie vyššie opísaného spôsobu. Táto súprava bude obsahoval značené vyššie opísané oligonukleotldy termostabilnú DNA polymerázu, roztoky areakčné ćinidlá na uskutočňovanie PCR reakcie a na kvantifikaćný test (napr. imunoenzýmový alebo fluorimetrický spôsob). Súprava môže tiež obsahovat inštrukcie na spravnu realizáciu spôsobu.Obrázky 1 a a 1 b DNA extrahovaná zo vzoriek stolice. Amplitikačne hladiny každej vzorky - vyjadrené v hmolnostných jednotkách (nanogramoch) - sa stanovujú zo zodpovedajúcich kalibračných krivlek (obr. 2 c). FL-DNA (fluorescenčná dlhá DNA) pre každú vzorku sa udáva ako súhrn množstiev (ng) troch skupin amplikónov p 53 - exóny 5-8, APC fragmenty 1-2 a 3-4.Obrázky Za a 2 b elektroferogramy získané ampliñkácíou známych množstiev DNA. AUC hodnoty sú normalizované (pIocha/100 ng) a vynesené do grafu oproti množstvu DNA (1, 2. 5. 10 a 20 ng). Obrazok 3 ROC krivka FL-DNA analýzy vzoriek stolice od pacientov a zdravých darcov.0022 Približne 4 g stolice sa rozpustilo pri teplote miestnosti. DNA sa extrahovala po 15 minútach homogenizàcie so 16 ml TE-9 tlmivého roztoku pH 9 (0,5 M Tris-HCI. 20 mM EDTA a 10 mM NaCI) prostredníctvom ULTRA-Turrax T 25 (Janke Kunkel GmbH Co. KG IKA-Labortechnik. Staufen, Nemecko). Po centrifugácii 5 000 g počas 15 minút sa supernatant preniesol do skúmavky, obsahujúcej 5 ml 7,5 M octanu amónneho (M-Medical, Florencia, Taliansko) a 30 ml 100 etanolu (Carlo Erba, Miláno, Taliansko). DNA sa izolovala centrifugáciou pri 5 000 g počas 15 minút pri teplote miestnosti. Vzorky stolice sa rozsuspendovali v 1,6 ml ASL tlmivého roztoku a DNA sa extrahovala použitlm súpravy QlAamp DNA Stool Kit (QIAGEN, Hilden.0023 Ampliñkácia exonov 5-8 p 53 a fragmentov 1-4 APC exónu 15 sa uskutočnila s 2 l DNA zo stolice v celkovom objeme 25 l, obsahujúcom 0,4 M každého priméra. 200 M deoxynuklotidtrifosfátov, 1 x reakčný tlmivý roztok s 3.5 mM Mgclz a 1 jednotkou Taq polymerazy (QIAGEN). Reakčná zmes sa podrobila 32 cyklom 60 x pri 94 °C a 60 x pri 60 C pre p 53 exóny, a pri 58 C pre APC fragmenty, a nasledovalo inkubovanie pri 72 C 60 x.0024 p 53 exóny sa amplifikovali súčasne v jedinej reakćnej zmesi a 4 APC fragmenty sa amplifikovali v dvoch rôznych zmesiach (zmes 1 - fragmenty 1 a 2 zmes 2 - fragmenty 3 a 4). Na tento účel sa priméry používané na L-DNA analýzu na svojom konci označili flurochrómami, poskytnutými ñrmou Applied Biosystems0025 Ampliñkácia 1 exony 5 až 5 p 53 génu (Gene Bank č. X 54156, nt. 13042-13253. 1330843489, 1398614124, 14404-14603). Amplifikácia 1 a 2 fragmenty zodpovedajúce aminokyselinám 862-954 a 1035-1130 exónu 15 APC génu (Gene Bank AF 127506, M 74088). Amplifikacia 3 a 4 fragmenty zodpovedajúce aminokyselinám 1288-1402 a 1421-1515 exónu 15 APC génu (Gene Bank AF 127506, M 74088).PS 3 exóny Označenie priméru Säznačenle SekvenciaAPC fragment Označenie priméru 5-značenie Sekvencia3 3 F gatgtaatcagacgacacag SR HEX ggcaatcgaacgactctcaa(pokračovanie) APC fragment Označenie priméru süznaćenie Sekvencia 4 4 F 6-faze cagtgatcttccagatagcc0026 Elektroforeza sa uskutočňovala použitím zariadenia 3100 Avant Genetic Analyzer (Applied Biosystems), ktorý bol vybavený s GeneScan Analysis 3.7.0027 FL-DNA sa uskutoćňovala analyzovaním intenzity fluorescencie pre každý vzorkovo špecifický PCR produkt (obr. 1 ab). Kvantiñkácia každej vzorky sa vypoćítala vo vzťahu k štandardnej krivke (l, 2, 5, 10 a 20 ng) genomickej DNA a vyjadrila sa v nanogramoch (obr. 2 abc). Na overenie prítomnosti alebo neprítomnosti Taq inhibitorov sa amplifikácia uskutočňovala na všetkých vzorkách so zmesou obsahujúcou 2 l DNA,extrahovanej zo stolice a 25 attogramov ag plazmidu s kontrolnou sekvenciou. Všetky určovania sa uskutočňovali dvojmo a opakovali sa približne v 20 vzoriek, ktorých odchýlka bola 20 .0028 Vzorky stolice od 86 pacientov s primárnym kolorektárnym karcinómom sa odohrali na Gastroenterologickom oddelení a chirurgickom oddelení Morgagni nemocnice vo Forli a na Oddelení onkológie a všeobecnej chirurgie Infermi nemocnice v Rimini. Vzorky stolice sa odohrali od 62 jednotlivcov, ktorí boli negatívni na rakovinu a benlgne lézie po kolonoskopii, a od personálu laboratórií.0029 Vzorky stolice sa odoberali najmenej tri dni po podani laxativnej liečby pri príprave na kolonoskopiu. aby sa ćrevá mohli zotavit a normálne fungovať. Vzorky fekàlií sa okamžite zmrazili a uskladnili sa pri -70 °C,maximálne na dva mesiace.0030 Histologicky sa potvrdila diagnóza rakoviny a definovalo sa jej patologlcké štádium podľa Dukesovej klasiñkácie 8 nádorov sa klasifikovalo ako štádium A, 30 ako štádium B, 37 ako štádium C a 9 ako štádium D. Okrem toho 19 rakovín sa lokalizovalo vo vzostupnom. 30 v zostupnom 2 v priečnom hrubom ćreve a 35 v rektálnom trakte. informácie o farbení neboli k dispozícii len v dvoch prípadoch.0031 Z 86 pacientov bolo 42 mužov a 44 boli ženy a stredný vek bol 72 rokov (rozsah 36 - 90 rokov). Zo 82 kontrol bolo 29 mužov a 33 bolo žien a stredný vek bol 51 rokov (rozsah 21 - 87 rokov).0032 Fluorescenčné signály boli v rozsahu O až 283 ng (stredná hodnota 47 ng) v stoliciach pacientov a v rozsahu 0 až 87 ng (stredná ,hodnota 4 ng) v stoliciach zdravých darcov. Ziadne rozdiely v stredových hodnotách sa nepozorovali v súvislosti s vekom pacientov, veľkosťou, miestom a štádiom nádora.0033 Ked sa porovnávali výsledky týchto dvoch prístupov, pozorovala sa priama úmernosľ, ale so širokou variabilitou FL-DNA hladín v rámci podskupín, deñnovaných podľa počtu L-DNA silných ampliñkácií. Okrem toho sa prostredníctvom FL-DNA spôsobu zistila fluorescencia u 33 zo 47 jedincov, ktorí nevykazovali žiadnu silnú amplifikáciu prostredníctvom L-DNA testu. Z týchto výsledkov jasne vyplýva vyššia citlivost fluorescenćného spôsobu v porovnaní s bežným prístupom.0034 Analýza ROC krivky FL-DNA hladín (obr, 3) dokazuje dobrú diagnostickú presnost tohto prístupu. Konkrétne sa pozorovala veľmi vysoká špecificita v rozsahu od 83 do 95 a vysoká citlivosť v rozsahu od 82 do 72 pre väčšinu diskriminaćných hraničných hodnôt 15, 20, 25 a 30 ng DNA (tabuľka 1). Keď sa analyzovala hranićná hodnota 25 ng, ktorá poskytuje najlepšiu celkovú presnost vo vzľahu k rôznym charakteristikám nádorov, citlivosť ostávala vysoká aj u pacientov s malými nádormi (70 ) v porovnani s pacientmi s veľkými nadormi (82 ), a bola podobná pre nádory v rôznom štádiu podľa Dukesovej klasifikácie(tabuľka 2). Dóležitejšie je, že podobná citlivosť sa pozorovala pri detekcii nádorov, lokalizovaných vo vzostupnom hrubom ćreve a nádorov Iokallzovaných v zostupnom hrubom čreve.DNA ZDRAVÍ DARCOVIA PACIENTIHraničná Pozitívni Negatívni Pozitivni Negatívni Citlivosť C.I. 95 pecificita C.I. 95 hodnota

MPK / Značky

MPK: C12Q 1/68

Značky: nádorov, identifikáciu, kolorektálnych, spôsob

Odkaz

<a href="http://skpatents.com/14-e8937-sposob-na-identifikaciu-kolorektalnych-nadorov.html" rel="bookmark" title="Databáza patentov Slovenska">Spôsob na identifikáciu kolorektálnych nádorov</a>

Podobne patenty